Direkt zum Inhalt
Merck

EHU071641

Sigma-Aldrich

MISSION® esiRNA

targeting human AQP3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GACAGAAGGAGCTGGTGTCCCGCTGCGGGGAGATGCTCCACATCCGCTACCGGCTGCTCCGACAGGCGCTGGCCGAGTGCCTGGGGACCCTCATCCTGGTGATGTTTGGCTGTGGCTCCGTGGCCCAGGTTGTGCTCAGCCGGGGCACCCACGGTGGTTTCCTCACCATCAACCTGGCCTTTGGCTTTGCTGTCACTCTGGGCATCCTCATCGCTGGCCAGGTCTCTGGGGCCCACCTGAACCCTGCCGTGACCTTTGCCATGTGCTTCCTGGCTCGTGAGCCCTGGATCAAGCTGCCCATCTACACCCTGGCACAGACGCTGGGAGCCTTCTTGGGTGCTGGAATAGTTTTTGGGCTGTATTATGATGCAATCTGGCACTTCGCCGACAACCAGCTTTTTGTTTCGGGCCCCAATGGCACAGCCGGCATCTTTGCTACCTACCCCTCTGGA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Mariko Hara-Chikuma et al.
Biochemical and biophysical research communications, 471(4), 603-609 (2016-02-21)
Aquaporin 3 (AQP3), a water/glycerol channel protein, is capable of transporting hydrogen peroxide (H2O2). Here, we show that AQP3-mediated intracellular H2O2 is involved in epidermal growth factor (EGF)-induced cell signaling and its dependent cell function in the EGF receptor (EGFR)-positive
Hiroki Satooka et al.
Molecular and cellular biology, 36(7), 1206-1218 (2016-02-03)
Most breast cancer mortality is due to clinical relapse associated with metastasis. CXCL12/CXCR4-dependent cell migration is a critical process in breast cancer progression; however, its underlying mechanism remains to be elucidated. Here, we show that the water/glycerol channel protein aquaporin-3
Ya-Jing Tan et al.
Scientific reports, 5, 17741-17741 (2015-12-05)
Hyperosmotic stress may induce apoptosis of different cells. However, oocytes show tolerance to osmotic stress during cryopreservation by vitrification, which is an assisted reproductive technique. The underlying mechanism is still not understood. Here, we demonstrated that hyperosmosis produced by high
Xiaoyong Wang et al.
Molecular medicine reports, 16(2), 1964-1972 (2017-06-29)
Aquaporin 3 (AQP3) and phospholipase D2 (PLD2) are abnormally expressed and/or localized in squamous cell carcinoma (SCC). AQP3 transports glycerol to PLD2 for the synthesis of lipid second messenger, which can mediate the effect of the AQP3/PLD2 signaling module in
Dieanira Erudaitius et al.
PloS one, 12(1), e0170442-e0170442 (2017-01-21)
Cancer cell toxicity to therapeutic H2O2 varies widely depending on cell type. Interestingly, it has been observed that different cancer cell types have varying peroxiporin expression. We hypothesize that variation in peroxiporin expression can alter cell susceptibility to therapeutic H2O2

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.