Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU059801

Sigma-Aldrich

MISSION® esiRNA

targeting human IGF1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTATGGCTCCAGCAGTCGGAGGGCGCCTCAGACAGGCATCGTGGATGAGTGCTGCTTCCGGAGCTGTGATCTAAGGAGGCTGGAGATGTATTGCGCACCCCTCAAGCCTGCCAAGTCAGCTCGCTCTGTCCGTGCCCAGCGCCACACCGACATGCCCAAGACCCAGAAGGAAGTACATTTGAAGAACGCAAGTAGAGGGAGTGCAGGAAACAAGAACTACAGGATGTAGGAAGACCCTCCTGAGGAGTGAAGAGTGACATGCCACCGCAGGATCCTTTGCTCTGCACGAGTTACCTGTTAAACTTTGGAACACCTACCAAAAAATAAGTTTGATAACATTTAAAAGATGGGCGTTTCCCCCAATGAAATACACAAGTAAACATTCCAACATTGTCTTTAGGAGTGATTTGCACCTTGCAAAAATGGTCCTG

Ensembl | Human Hinterlegungsnummer

ENSG00000017427

NCBI-Hinterlegungsnummer

NM_000618

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... IGF1(3479) , IGF1(3479)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Saidan Ding et al.
Frontiers in cellular neuroscience, 11, 258-258 (2017-09-22)
Insulin-like growth factor I (IGF-I) has been positively correlated with cognitive ability. Cognitive decline in minimal hepatic encephalopathy (MHE) was shown to be induced by elevated intracranial dopamine (DA). The beneficial effect of IGF-I signaling in MHE remains unknown. In
Binqiang Tian et al.
Journal of drug targeting, 25(7), 626-636 (2017-03-14)
We have previously reported that curcumin inhibits urothelial tumor development in a rat bladder carcinogenesis model. In this study, we report that curcumin inhibits urothelial tumor development by suppressing IGF2 and IGF2-mediated PI3K/AKT/mTOR signaling pathway. Curcumin inhibits IGF2 expression at
P Cao et al.
Osteoarthritis and cartilage, 27(2), 336-346 (2018-12-07)
This study aimed to explore potential microRNAs (miRNAs), which participate in the pathological process of condylar hyperplasia (CH) through targeting specific proliferation- and apoptosis- related genes of chondrocytes. Insulin-like growth factor 1 (IGF1), IGF1 receptor (IGF1R) and B-cell CLL/lymphoma 2
Yan He et al.
Fitoterapia, 124, 200-205 (2017-11-21)
Insulin-like growth factor I (IGF-I) and binding protein 3 (IGFBP-3) play a role in the maintenance of gut mucosal barrier function. Nevertheless, IGF-I/IGFBP-3 and tight junction protein (TJP) expression in small intestinal mucosa are often impaired during endotoxemia. In this
Yuan Ni et al.
The Journal of endocrinology (2019-07-26)
Prenatal ethanol exposure (PEE) adversely affects the offspring reproductive system. We aimed to confirm the susceptibility to premature ovarian insufficiency (POI) in female PEE offspring and elucidate its intrauterine programming mechanism. The pregnant Wistar female rats were intragastrically administered with
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.