Direkt zum Inhalt
Merck

EHU010121

Sigma-Aldrich

MISSION® esiRNA

targeting human STAT1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCGTTTTCATGACCTCCTGTCACAGCTGGATGATCAATATAGTCGCTTTTCTTTGGAGAATAACTTCTTGCTACAGCATAACATAAGGAAAAGCAAGCGTAATCTTCAGGATAATTTTCAGGAAGACCCAATCCAGATGTCTATGATCATTTACAGCTGTCTGAAGGAAGAAAGGAAAATTCTGGAAAACGCCCAGAGATTTAATCAGGCTCAGTCGGGGAATATTCAGAGCACAGTGATGTTAGACAAACAGAAAGAGCTTGACAGTAAAGTCAGAAATGTGAAGGACAAGGTTATGTGTATAGAGCATGAAATCAAGAGCCTGGAAGATTTACAAGATGAATATGACTTCAAATGCAAAACCTTGCAGAACAGAGAACACGAGACCAATGGTGTGGCAAAGAGTGATCAGAAACAAGAACAGCTGTTACTCAAGAAGATGTATTTAATGCTTGACAATAAGAGAAAGGAAGTAGTTCACAAAATAATAGAGTTGCTGAATGTCACTGAACTTACCCAGAATGCCC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Sophia Hatziieremia et al.
Molecular carcinogenesis, 55(11), 1667-1677 (2015-10-27)
STAT1 loss has previously been implicated in cell line studies to modify prostate cancer cell growth and survival, however the clinical significance of this has not previously been established. This study investigated if STAT1 loss was associated with patient outcome
Bin Huang et al.
Nature communications, 7, 13885-13885 (2016-12-15)
Communication between osteoblasts and endothelial cells (ECs) is essential for bone turnover, but the molecular mechanisms of such communication are not well defined. Here we identify Cxcl9 as an angiostatic factor secreted by osteoblasts in the bone marrow microenvironment. We
Lan-Juan Zhao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 40(1-2), 77-90 (2016-11-18)
Signal transducer and activator of transcription (STAT) pathway plays an important role in antiviral efficacy of interferon alpha (IFN-α). IFN-α is the main therapeutic against hepatitis C virus (HCV) infection. We explored effects of IFN-α on HCV replication and antiviral
Yonglei Liu et al.
Oncotarget, 8(24), 39559-39570 (2017-05-04)
Carcinoma associated fibroblasts (CAFs) play important roles in breast cancer development and progression. Recent studies show that microRNAs (miRNAs) are the main regulators in CAFs. MiR-29b is one of the significant down-regulated miRNAs in CAFs from the miRNA screening. The
Makoto Fujii et al.
World journal of gastroenterology, 23(30), 5519-5529 (2017-08-31)
To investigate interleukin (IL)-26 expression in the inflamed mucosa of patients with inflammatory bowel disease (IBD) and the function of IL-26. Human colonic subepithelial myofibroblasts (SEMFs) were isolated from colon tissue surgically resected. The expression of IL-26 protein and its

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.