Skip to Content
Merck
All Photos(1)

Key Documents

EMU050191

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mmp14

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTCCGAGGAGAGATGTTTGTCTTCAAGGAGCGATGGTTCTGGCGGGTGAGGAATAACCAAGTGATGGATGGATACCCAATGCCCATTGGCCAATTCTGGAGGGGCCTGCCTGCATCCATCAATACTGCCTACGAAAGGAAGGATGGCAAATTTGTCTTCTTCAAAGGAGATAAGCACTGGGTGTTTGACGAAGCCTCCCTGGAACCCGGGTACCCCAAGCACATTAAGGAGCTTGGCCGAGGGCTGCCCACGGACAAGATCGATGCAGCTCTCTTCTGGATGCCCAATGGGAAGACCTACTTCTTCCGGGGCAATAAGTACTACCGGTTCAATGAAGAATTCAGGGCAGTGGACAGCGAGTACCCTAAAAACATCAAAGTCTGGGAAGGAATCCCTGAATCTCCCAGGGGGTCATTCATGGGCAGTGATG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Evelyne Tassone et al.
Journal of cellular physiology, 230(2), 366-377 (2014-07-06)
Membrane-type 1 matrix metalloproteinase (MT1-MMP, MMP-14), a transmembrane proteinase with an extracellular catalytic domain and a short cytoplasmic tail, degrades extracellular matrix components and controls diverse cell functions through proteolytic and non-proteolytic interactions with extracellular, intracellular, and transmembrane proteins. Here
Bi-Sen Ding et al.
Journal of cell science, 128(16), 2983-2988 (2015-06-28)
Human airway basal cells are the stem (or progenitor) population of the airway epithelium, and play a central role in anchoring the epithelium to the basement membrane. The anatomic position of basal cells allows for potential paracrine signaling between them
Naohiko Koshikawa et al.
Cancer research, 75(16), 3327-3339 (2015-07-02)
Eph receptor tyrosine kinases are considered candidate therapeutic targets in cancer, but they can exert opposing effects on cell growth. In the presence of its ligands, Eph receptor EphA2 suppresses signaling by other growth factor receptors, including ErbB, whereas ligand-independent
Dane K Lund et al.
American journal of physiology. Cell physiology, 307(2), C140-C149 (2014-06-06)
The twenty-five known matrix metalloproteases (MMPs) and their endogenous inhibitors, tissue inhibitors of metalloproteases (TIMPs), mediate cell invasion through the extracellular matrix (ECM). In a comparative three-dimensional assay, we analyzed human and mouse satellite cells' competence to invade an artificial

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service