Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU144441

Sigma-Aldrich

MISSION® esiRNA

targeting human SNX5

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCCTCGCTTCAGATTGACATACCTGATGCGCTCAGTGAGAGAGACAAAGTCAAATTTACAGTGCACACAAAGACCACACTGCCCACGTTTCAGAGCCCAGAGTTTTCTGTTACAAGGCAACATGAAGACTTTGTGTGGCTACATGACACTCTTATTGAAACAACAGACTATGCTGGGCTTATTATTCCACCTGCTCCTACGAAGCCCGACTTTGATGGTCCTCGAGAGAAGATGCAGAAACTGGGAGAAGGTGAAGGGTCTATGACCAAAGAAGAATTTGCCAAGATGAAACAAGAACTGGAAGCTGAGTATCTCGCTGTGTTTAAGAAGACTGTGTCCTCCCATGAAGTCTTTCTTCAGCGGCTTTCTTCTCACCCTGTTCTCAGTAAAGATCGCAACTTTCATGTTTTCCTGGAATATGATCAGGATCTAAGTGTTAGGCGGAAAAATACTAAAGAGATGTTTGGTGGCTTCTTCAAA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Nao Itai et al.
PloS one, 13(11), e0207205-e0207205 (2018-11-13)
Sorting nexin 5 (SNX5), a member of sorting nexin family, plays an important role in membrane trafficking, including the retrograde trafficking of the cation independent mannose 6-phosphate receptor (CI-M6PR) and macropinocytosis. Using ESI-LCMS/MS analysis, we confirmed that SNX5 serine 226
Jinyang Cai et al.
Journal of Cancer, 10(13), 2942-2952 (2019-07-10)
Head and neck squamous cell carcinoma (HNSCC) is the sixth most prevalent cancer worldwide. Long-term survival rates in patients with HNSCC have not increased significantly in the past 30 years. Therefore, looking for novel molecular targets that control HNSCC progression
Fengmin Li et al.
Endocrinology, 156(6), 2211-2221 (2015-04-01)
Sorting nexin 5 (SNX5) belongs to the SNX family, which is composed of a diverse group of proteins that mediate trafficking of plasma membrane proteins, receptors, and transporters. SNX5 is important in the resensitization of the dopamine D1-like receptor (D1R).
Ming Sun et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(2), 2730-2748 (2020-01-08)
The small GTPase Ras-related protein Rab-7a (Rab7a) serves as a key organizer of the endosomal-lysosomal system. However, molecular mechanisms controlling Rab7a activation levels and subcellular translocation are still poorly defined. Here, we demonstrate that type Igamma phosphatidylinositol phosphate 5-kinase i5

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.