Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU093121

Sigma-Aldrich

MISSION® esiRNA

targeting human CTTN

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CTTGGGAAGGAAGGCAGTGCCTGCTCTGCTGTGAGCCGCCAGGAACCCTCCTCCTGTCAATGGGGGTGTAGTATTTTTGCCAAAATATCATGTTCAATTTCAGTAGTTTGATCAGTTGAAGGCTAGAAGTGTGAAGTGCAGATGAGTGTGTGTTCTTCCCCAAGGTCCCCCCACAGCTCCAGGACACCGCTGTCCTGGCATTTGTGGCCACTCACTTTGTAGGAAACTCATCTCCTTCCTGAGGAGCCGGGAGGCTGGACCAGTCCCGTCGTGCAGTCAGGTGGGCGGTGTGTCTTTCCAGAAGGTCACGTGGAAATGTCTCGGGACTTGGGTCCCGGAGTGCCCGTGAAGCGTGTTTTTGCTCCTGAGGTGCATTTTCTCATCATCCTTGCTTTACCACAATGAGCAATGAGGTCGGGTTTTA

N° accesso Ensembl | uomo

ENSG00000085733

N° accesso NCBI

NM_138565

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... CTTN(2017) , CTTN(2017)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Rachel J Watkins et al.
The Journal of clinical endocrinology and metabolism, 101(12), 4551-4563 (2016-09-08)
Metastatic disease is responsible for the majority of endocrine cancer deaths. New therapeutic targets are urgently needed to improve patient survival rates. The proto-oncogene PTTG1-binding factor (PBF/PTTG1IP) is overexpressed in multiple endocrine cancers and circumstantially associated with tumor aggressiveness. This
Xiaojian Zhang et al.
Oncotarget, 8(1), 1541-1554 (2016-12-03)
Cortactin (CTTN) is overexpressed in various tumors, including head and neck squamous cell carcinoma and colorectal cancer (CRC), and can serve as a biomarker of cancer metastasis. We observed that CTTN promotes cancer cell proliferation in vitro and increases CRC
Dominik Horn et al.
Head & neck, 40(12), 2685-2694 (2018-11-21)
Cortactin (CTTN) is located on chromosome 11q13 and is associated with invasiveness in various cancer entities. CTTN protein expression could be a prognosticator of oral squamous cell carcinoma (OSCC) in terms of recurrence and survival. CTTN-dependent invasion was performed using
Yang Cheng et al.
Gynecological endocrinology : the official journal of the International Society of Gynecological Endocrinology, 34(10), 853-858 (2018-04-17)
Vascular endothelial growth factor C (VEGF-C) accelerates cervical cancer metastasis, while the detailed mechanism remains largely unknown. Recent evidence indicates that microRNA play a crucial role in controlling cancer cell invasiveness. In the present study, we investigated the role of
Steven M Markwell et al.
Molecular cancer research : MCR, 17(4), 987-1001 (2019-01-06)
Malregulation of the actin cytoskeleton enhances tumor cell motility and invasion. The actin-binding protein cortactin facilitates branched actin network formation through activation of the actin-related protein (Arp) 2/3 complex. Increased cortactin expression due to gene amplification is observed in head
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.