Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU055401

Sigma-Aldrich

MISSION® esiRNA

targeting human BAG1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AGCAATGAGAAGCACGACCTTCATGTTACCTCCCAGCAGGGCAGCAGTGAACCAGTTGTCCAAGACCTGGCCCAGGTTGTTGAAGAGGTCATAGGGGTTCCACAGTCTTTTCAGAAACTCATATTTAAGGGAAAATCTCTGAAGGAAATGGAAACACCGTTGTCAGCACTTGGAATACAAGATGGTTGCCGGGTCATGTTAATTGGGAAAAAGAACAGTCCACAGGAAGAGGTTGAACTAAAGAAGTTGAAACATTTGGAGAAGTCTGTGGAGAAGATAGCTGACCAGCTGGAAGAGTTGAATAAAGAGCTTACTGGAATCCAGCAGGGTTTTCTGCCCAAGGATTTGCAAGCTGAAGCTCTCTGCAAACTTGATAGGAGAGTAAAAGCCACAATAGAGCAGTTTATGAAGATCTTGGAGGAGATTGACACACTGATCCTGCCAGAAA

N° accesso Ensembl | uomo

ENSG00000107262

N° accesso NCBI

NM_004323

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... BAG1(573) , BAG1(573)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Shutong Liu et al.
Journal of translational medicine, 15(1), 189-189 (2017-09-08)
In order to improve therapy for head and neck squamous cell carcinoma (HNSCC), biomarkers associated with local and/or distant tumor relapses and cancer drug resistance are urgently needed. This study identified a potential biomarker, Bcl-2 associated athanogene-1 (BAG-1), that is
Pelin Ozfiliz Kilbas et al.
Molecular biology reports, 46(1), 847-860 (2019-01-21)
The multifunctional anti-apoptotic Bag-1 protein has important roles in apoptosis, proteasome-mediated degradation, transcriptional regulation, and intracellular signaling. Bag-1 promotes cell survival and proliferation, and is overexpressed in breast cancer. Therefore, Bag-1-targeted therapy might be a promising strategy to treat breast
Zhili Shen et al.
Molecular medicine reports, 17(5), 7435-7441 (2018-03-24)
Cinobufacini is widely used in the treatment of advanced cancers. It has been previously reported that microRNA (miR)‑494 was upregulated in cinobufacini‑treated gastric cancer cells; however, the detailed role of miR‑494 in the anti‑tumor activity of cinobufacini is unclear. The
Pelin Ozfiliz et al.
Cell biochemistry and function, 33(5), 293-307 (2015-07-17)
Bag-1, Bcl-2 associated athanogene-1, is a multifunctional protein that can regulate a wide variety of cellular processes: proliferation, cell survival, transcription, apoptosis and motility. Bag-1 interacts with various targets in the modulation of these pathways; yet molecular details of Bag-1's

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.