SPUD Assay for Detection of Assay Inhibitors Protocol

Quantitative PCR Protocols

Although quantitative PCR uses the same basic concept as traditional PCR, the reactions differ in that the amplicons are generally smaller and are detected indirectly using an additional dye or labeled probe or primer.

The SPUD assay is one option for identification of inhibitors that may be present in RNA or DNA samples. The assay is particularly useful when a large number of samples are to be analyzed or when targets are present at low copy number making dilution of the sample impractical. The test is used to avoid false negatives and to lend greater confidence to reporting of data based on a negative result.

The SPUD assay consists of an artificial template and two primers that are specific to the template and is run in the presence of SYBR^® Green I dye or a template specific probe. During the assay, the SPUD template is amplified, resulting in a characteristic C_q. Alongside this control reaction, the artificial template is spiked into samples and measured in comparison to the control. In the presence of a clean sample, the C_q will remain the same as the SPUD control whereas in the presence of a contaminated sample, the C_q will shift to higher cycles.

Equipment

• Quantitative PCR instrument
  
• Microcentrifuge
  
• Laminar flow hood for PCR set up (optional)

Supplies

• Sterile filter pipette tips
  
• Sterile 1.5 mL screw-top microcentrifuge tubes (CLS430909)
  
• PCR tubes and plates, select one to match desired format:
  • Individual thin-walled 200 μL PCR tubes (Z374873 or P3114)
  • Plates
  - 96-well plates (Z374903)
  - 384-well plates (Z374911)
  • Plate seals
  - ThermalSeal RTS™ Sealing Films (Z734438)
  - ThermalSeal RT2RR™ Film (Z722553)

Reagents

• cDNA/gDNA (or other sample for inhibitor test) diluted as for use in qPCR (usually 1:10). For the purposes of the following example protocol, cDNA is referred to as the test sample. However, any material may be monitored for inhibitory compounds. In this example, the amplification is monitored using SYBR^® Green I detection but a probe may be used as an alternative (listed as optional probe) and the reagents should be amended to a suitable probe detection master mix (e.g., LuminoCt^® qPCR ReadyMix, L6669).
• KiCqStart^® SYBR^® Green I ReadyMix (KCQS00/KCQS01/KCQS02/KCQS03) — see Table P4-6A to select appropriate reagents for the instrument) or LuminoCt^® qPCR ReadyMix (L6669) if a probe is used for detection.
  
• PCR grade water: PCR grade water (W1754 or W4502) as 20 mL aliquots; freeze; use a fresh aliquot for each reaction.
• Forward and Reverse primers for SPUD assay (stock at 10 μM; Table 1). Optional SPUD probe FAMTGCACAAGCTATGGAACACCACGT-BHQ1 for use with a probe compatible LuminoCt^® ReadyMix™ (L6669).
  
• SPUD template oligo diluted to approximately 20,000 copies/μL from a stock concentration of 100 μM: Dilute 100 μM through 1:10 dilution series and test the 6th to 10th dilution for the concentration that yields a C_q of approximately 25. Dilute template from a 1:1,000× stock for each test.

Table 1. qPCR Cycling Conditions for SPUD Inhibitor Test.

Primer	Sequence (5’-3’)
SPUD Template	AACTTGGCTTTAATGGACCTCCAATTTTGAGTGTGCACAAGCTATGGAA CACCACGTAAGACATAAAACGGCCACATATGGTGCCATGTAAGGATGAATGT
SPUD Forward	AACTTGGCTTTAATGGACCTCCA
SPUD Reverse	ACATTCATCCTTACATGGCACCA

Method

1. Place all reaction components on ice.

2. Mix and then centrifuge briefly to collect contents at the bottom of the tube.

3. Determine the total number of samples to be tested in duplicate and also allow for two No Test Sample Controls.

4. Prepare master mix for all samples and controls according to Table 1 allowing 10% extra to allow for pipetting
error. Mix well.

Table 2. qPCR Master Mix for SPUD Inhibitor Test.

Reagent	Volume (μL) per Single 25 μL Reaction
2× KiCqStart® ReadyMix	12.5
SPUD Primer F (10 μM stock	0.25
SPUD Primer R (10 μM stock)	0.25
SPUD template (pre diluted to 20,000 copies/μL)	1
Reference dye (instrument specific, see Table P4-7)	1
PCR grade water	5

5. Aliquot 20 μL of SPUD qPCR master mix into the sample tubes/wells. If using a PCR plate, follow a plate schematic to
ensure that the reagents, samples and controls are added to the right wells.

6. Aliquot 5 μL cDNA sample into qPCR tubes/wells and 5 μL water to the No Test Sample Control tubes/wells.

7. Cap tubes or seal the PCR plate and label. (Make sure the labeling does not obscure instrument excitation/detection
light path.)

8. Run samples using the two-step protocol provided below, repeating steps 1–2 for 40 cycles.

Table 3. qPCR Cycling Conditions for SPUD Inhibitor Test.

Cycling Conditions	Temp (°C)	Time (sec)
Initial Hot Start/denaturation	95	30
Steps 1–2 are repeated through 40 cycles
Step 1	95	5
Step 2	60	20

Note: Use standards dissociation curve protocol (data collection)