Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU071691

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Clk1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCCTTGCAAGCTTTGTCTTCAGGGTTGGAAAGATGAGACATTCAAAGAGAACTTACTGTCCTGACTGGGATGAAAGAGACTGGGATTATGGAACATGGAGAAGCAGCAGCAGTCACAAAAGAAAGAAGAGATCACATAGCAGCGCCCGTGAGCAAAAGCGCTGCAGGTACGATCACTCCAAAACGACAGACAGCTATTATCTGGAAAGCAGATCCATAAATGAGAAAGCTTATCATAGTCGACGCTATGTTGATGAATACAGGAATGACTACATGGGCTACGAGCCAGGGCATCCCTATGGAGAACCTGGAAGCAGATACCAGATGCATAGTAGCAAGTCCTCTGGTAGGAGTGGAAGAAGCAGTTACAAAAGTAAACACAGGAGTCGCCACCACACATCGCAGCACCATTCACACGGGATGAAATTGTTG

Numéro d'accès Ensembl | souris

ENSMUSG00000026034

Numéro d'accès NCBI

NM_009905

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... CLK1(12747) , Clk1(12747)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Apiruck Watthanasurorot et al.
PLoS genetics, 9(3), e1003361-e1003361 (2013-04-05)
Daily, circadian rhythms influence essentially all living organisms and affect many physiological processes from sleep and nutrition to immunity. This ability to respond to environmental daily rhythms has been conserved along evolution, and it is found among species from bacteria
Egle Jakubauskiene et al.
The Journal of biological chemistry, 290(29), 18079-18089 (2015-05-30)
The removal of introns from mRNA precursors (pre-mRNAs) is an essential step in eukaryotic gene expression. The splicing machinery heavily contributes to biological complexity and especially to the ability of cells to adapt to altered cellular conditions. Inhibitory PAS domain

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique