Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU226031

Sigma-Aldrich

MISSION® esiRNA

targeting human IRF9, RP11-468E2.4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAGCTGTCTGGAAGACTCGCCTGCGCTGTGCACTCAACAAGAGTTCTGAATTTAAGGAGGTTCCTGAGAGGGGCCGCATGGATGTTGCTGAGCCCTACAAGGTGTATCAGTTGCTGCCACCAGGAATCGTCTCTGGCCAGCCAGGGACTCAGAAAGTACCATCAAAGCGACAGCACAGTTCTGTGTCCTCTGAGAGGAAGGAGGAAGAGGATGCCATGCAGAACTGCACACTCAGTCCCTCTGTGCTCCAGGACTCCCTCAATAATGAGGAGGAGGGGGCCAGTGGGGGAGCAGTCCATTCAGACATTGGGAGCAGCAGCAGCAGCAGCAGCCCTGAGCCACAGGAAGTTACAGACACAACTGAGGCCCCCTTTCAAGGGGATCAGAGGTCCCTGGAGTTTCTGCTTCCTCCAGAGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Nicholas Hernandez et al.
The Journal of experimental medicine, 215(10), 2567-2585 (2018-08-26)
Life-threatening pulmonary influenza can be caused by inborn errors of type I and III IFN immunity. We report a 5-yr-old child with severe pulmonary influenza at 2 yr. She is homozygous for a loss-of-function IRF9 allele. Her cells activate gamma-activated
Nadiia Lypova et al.
Cancers, 11(5) (2019-05-19)
While clinical responses to palbociclib have been promising, metastatic breast cancer remains incurable due to the development of resistance. We generated estrogen receptor-positive (ER+) and ER-negative (ER-) cell line models and determined their permissiveness and cellular responses to an oncolytic
Adriana Forero et al.
Immunity, 51(3), 451-464 (2019-09-01)
Type I and III interferons (IFNs) activate similar downstream signaling cascades, but unlike type I IFNs, type III IFNs (IFNλ) do not elicit strong inflammatory responses in vivo. Here, we examined the molecular mechanisms underlying this disparity. Type I and III
Marieke C Verweij et al.
PLoS pathogens, 11(5), e1004901-e1004901 (2015-05-15)
Varicella zoster virus (VZV) causes chickenpox in humans and, subsequently, establishes latency in the sensory ganglia from where it reactivates to cause herpes zoster. Infection of rhesus macaques with simian varicella virus (SVV) recapitulates VZV pathogenesis in humans thus representing

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique