Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU107101

Sigma-Aldrich

MISSION® esiRNA

targeting human PPIA

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCTTTGGGTCCAGGAATGGCAAGACCAGCAAGAAGATCACCATTGCTGACTGTGGACAACTCGAATAAGTTTGACTTGTGTTTTATCTTAACCACCAGATCATTCCTTCTGTAGCTCAGGAGAGCACCCCTCCACCCCATTTGCTCGCAGTATCCTAGAATCTTTGTGCTCTCGCTGCAGTTCCCTTTGGGTTCCATGTTTTCCTTGTTCCCTCCCATGCCTAGCTGGATTGCAGAGTTAAGTTTATGATTATGAAATAAAAACTAAATAACAATTGTCCTCGTTTGAGTTAAGAGTGTTGATGTAGGCTTTATTTTAAGCAGTAATGGGTTACTTCTGAAACATCACTTGTTTGCTTAATTCTACACAGTACTTAGATTTTTTTTACTTTCCAGTCCCAGGAAGTGTCAATGTTTGTTGAGTGGAATATTGAAAATGTAGGCAGCAACTGGG

Numéro d'accès Ensembl | humain

ENSG00000196262

Numéro d'accès NCBI

NM_021130

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PPIA(5478) , PPIA(5478)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

N Doti et al.
Cell death & disease, 5, e993-e993 (2014-01-18)
Delayed neuronal cell death largely contributes to the progressive infarct development and associated functional impairments after cerebral ischemia or brain trauma. Previous studies exposed a key role for the interaction of the mitochondrial protein apoptosis-inducing factor (AIF) and cytosolic cyclophilin
Hiroya Fujioka et al.
Oncology letters, 13(1), 289-295 (2017-01-27)
Paclitaxel is widely used to treat various cancers; however, resistance to this drug is a major obstacle to breast cancer chemotherapy. To identify the proteins involved in paclitaxel resistance, the present study compared the proteomes of MCF-7 human breast cancer
Hiroaki Takeuchi et al.
Retrovirology, 9, 3-3 (2012-01-10)
An understanding of host cell factors that affect viral replication contributes to elucidation of the mechanism for determination of viral tropism. Cyclophilin A (CypA), a peptidyl-prolyl cis-trans isomerase (PPIase), is a host factor essential for efficient replication of human immunodeficiency
Zhi-Ying Qi et al.
Journal of ovarian research, 12(1), 118-118 (2019-12-01)
Ovarian cancer (OC) is a type of gynaecological malignancy with high mortality in females. Serous ovarian cancer (SOC) is a distinct subtype of OC with poor early diagnosis. Given the limitations of traditional therapies, such as chemotherapy, targeted treatment is
Huan Zhang et al.
PloS one, 9(3), e92824-e92824 (2014-03-26)
Hypoxia-inducible factor-1α (HIF-1α) is a highly important transcription factor involved in cell metabolism. HIF-1α promotes glycolysis and inhibits of mitochondrial respiration in pancreatic ductal adenocarcinoma (PDAC). In response to tumor hypoxia, cyclophilin A (CypA) is over-expressed in various cancer types
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique