Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU069501

Sigma-Aldrich

MISSION® esiRNA

targeting human SMAD2 (2)

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATTGAGCCACAGAGTAATTATATTCCAGAAACGCCACCTCCTGGATATATCAGTGAAGATGGAGAAACAAGTGACCAACAGTTGAATCAAAGTATGGACACAGGCTCTCCAGCAGAACTATCTCCTACTACTCTTTCCCCTGTTAATCATAGCTTGGATTTACAGCCAGTTACTTACTCAGAACCTGCATTTTGGTGTTCGATAGCATATTATGAATTAAATCAGAGGGTTGGAGAAACCTTCCATGCATCACAGCCCTCACTCACTGTAGATGGCTTTACAGACCCATCAAATTCAGAGAGGTTCTGCTTAGGTTTACTCTCCAATGTTAACCGAAATGCCACGGTAGAAAT

Numéro d'accès Ensembl | humain

ENSG00000175387

Numéro d'accès NCBI

NM_005901

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SMAD2(4087) , SMAD2(4087)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ping Zhao et al.
Cancer chemotherapy and pharmacology, 84(2), 427-439 (2019-05-16)
Although DNA-mismatch-repair-deficient (dMMR) status and aberrant expression of miRNAs are both critically implicated in the pathogenesis of resistance to 5-fluorouracil (5-FU) in colorectal cancer (CRC), whether these two factors regulate tumor response to 5-FU in a coordinated manner remains unknown.
Qingde Wa et al.
Oncology reports, 39(1), 81-90 (2017-11-16)
Constitutive activation of TGF‑β signaling pathway is a well-documented mechanism responsible for the bone metastasis of prostate cancer (PCa). MicroRNAs (miRNAs) have been reported to be crucial for the activation of TGF‑β signaling via targeting downstream components of TGF‑β signaling
Wei Zhang et al.
Journal of Cancer, 12(6), 1678-1686 (2021-02-23)
Circular RNAs (circRNAs) are associated with various diseases, including cancers. However, their roles in colorectal cancer (CRC) have not been established. Hsa_circ_0000847 (circ_SMAD2) is a novel circRNA that was found to be elevated in CRC cell lines and tissues. High
Benjamin V Park et al.
Cancer discovery, 6(12), 1366-1381 (2016-09-30)
Programmed death-1 (PD-1) is a coinhibitory receptor that downregulates the activity of tumor-infiltrating lymphocytes (TIL) in cancer and of virus-specific T cells in chronic infection. The molecular mechanisms driving high PD-1 expression on TILs have not been fully investigated. We
Ayesha Ghayur et al.
American journal of physiology. Renal physiology, 317(1), F152-F162 (2019-05-30)
Glomerulonephritis (GN) is a common cause of end-stage kidney disease and is characterized by glomerular inflammation, hematuria, proteinuria, and progressive renal dysfunction. Transforming growth factor (TGF)-β is involved in glomerulosclerosis and interstitial fibrosis. TGF-β activates multiple signaling pathways, including the
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique