Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU050931

Sigma-Aldrich

MISSION® esiRNA

targeting human CD14

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCCGCTGTGTAGGAAAGAAGCTAAAGCACTTCCAGAGCCTGTCCGGAGCTCAGAGGTTCGGAAGACTTATCGACCATGGAGCGCGCGTCCTGCTTGTTGCTGCTGCTGCTGCCGCTGGTGCACGTCTCTGCGACCACGCCAGAACCTTGTGAGCTGGACGATGAAGATTTCCGCTGCGTCTGCAACTTCTCCGAACCTCAGCCCGACTGGTCCGAAGCCTTCCAGTGTGTGTCTGCAGTAGAGGTGGAGATCCATGCCGGCGGTCTCAACCTAGAGCCGTTTCTAAAGCGCGTCGATGCGGACGCCGACCCGCGGCAGTATGCTGACACGGTCAAGGCTCTCCGCGTGCGGCGGCTCACAGTGGGAGCCGCACAGGTTCCTGCTCAGCTACTGGTAGGCGCCCTGCGTGTGCTAGCGTACTCCCGCCTCAAGGAACTGACGCTCGAGGACCTA

Numéro d'accès Ensembl | humain

ENSG00000170458

Numéro d'accès NCBI

NM_000591

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CD14(929) , CD14(929)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mai Fujikura et al.
Journal of Alzheimer's disease : JAD, 68(1), 323-337 (2019-02-19)
We previously demonstrated that microglia play an essential role in clearance of amyloid-β (Aβ) in Alzheimer's disease (AD)-like pathology. Our prior work also showed that several receptors expressed on microglia participated in Aβ phagocytosis. However, clathrin-mediated endocytosis (CME), which is
Nathalie Bonello-Palot et al.
Atherosclerosis, 237(1), 45-52 (2014-09-10)
Defects in lamin A maturation result in premature aging syndromes and severe atherosclerosis as observed in the Hutchinson-Gilford Progeria Syndrome. In age-related atherosclerosis, several features of cellular senescence have been characterized in endothelial cells including telomere shortening and increased oxidative
Elena M V de Cavanagh et al.
American journal of physiology. Heart and circulatory physiology, 307(2), H207-H215 (2014-05-27)
Early endothelial progenitor cells (early EPC) and late EPC are involved in endothelial repair and can rescue damaged endothelial cells by transferring organelles through tunneling nanotubes (TNT). In rodents, EPC mobilization from the bone marrow depends on sympathetic nervous system

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique