Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU009031

Sigma-Aldrich

MISSION® esiRNA

targeting human TNNC1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTACAAGGCTGCGGTAGAGCAGCTGACAGAAGAGCAGAAAAATGAGTTCAAGGCAGCCTTCGACATCTTCGTGCTGGGCGCTGAGGATGGCTGCATCAGCACCAAGGAGCTGGGCAAGGTGATGAGGATGCTGGGCCAGAACCCCACCCCTGAGGAGCTGCAGGAGATGATCGATGAGGTGGACGAGGACGGCAGCGGCACGGTGGACTTTGATGAGTTCCTGGTCATGATGGTTCGGTGCATGAAGGACGACAGCAAAGGGAAATCTGAGGAGGAGCTGTCTGACCTCTTCCGCATGTTTGACAAAAATGCTGATGGCTACATCGACCTGGATGAGCTGAAGATAATGCTGCAGGCTACAGGCGAGACCATCACGGAGGACGACATCGAGGAGCTCATGAAGGACGGAGACAAGAACAACGACGGCCGCATCGACTATGATGAGTTCCTGGAGTTCATGAAGGGTGTGGAGTAGATGCTGACCTTCACCCAGAGCTGCCTATGCCCAGCCTCCAACTCCAGCTGAGTCCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Juan L Vivero-Escoto et al.
Journal of materials chemistry. B, 7(46), 7396-7405 (2019-11-09)
Chronic liver dysfunction often begins with hepatic fibrosis. A pivotal event in the progression of liver fibrosis and cirrhosis is hepatic stellate cell (HSC) activation and secretion of extracellular matrix proteins, including tenascin-C (TnC). TnC is often chosen as a
Elena Jachetti et al.
Cancer research, 75(10), 2095-2108 (2015-03-27)
Precociously disseminated cancer cells may seed quiescent sites of future metastasis if they can protect themselves from immune surveillance. However, there is little knowledge about how such sites might be achieved. Here, we present evidence that prostate cancer stem-like cells

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique