Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

Autres documents

EHU005681

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CATGAACTCGGCCATTCTCTTGGACTCTCCCATTCTACTGATATCGGGGCTTTGATGTACCCTAGCTACACCTTCAGTGGTGATGTTCAGCTAGCTCAGGATGACATTGATGGCATCCAAGCCATATATGGACGTTCCCAAAATCCTGTCCAGCCCATCGGCCCACAAACCCCAAAAGCGTGTGACAGTAAGCTAACCTTTGATGCTATAACTACGATTCGGGGAGAAGTGATGTTCTTTAAAGACAGATTCTACATGCGCACAAATCCCTTCTACCCGGAAGTTGAGCTCAATTTCATTTCTGTTTTCTGGCCACAACTGCCAAATGGGCTTGAAGCTGCTTACGAATTTGCCGACAGAGATGAAGTCCGGTTTTTCAAAGGGAATAAGTACTGGGCTGTTCAGGGACAGAATGTGCTACACGGATACCCCAAGGA

Numéro d'accès Ensembl | humain

ENSG00000196611

Numéro d'accès NCBI

NM_002421

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... MMP1(4312) , MMP1(4312)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shuichi Shimada et al.
Journal of dermatological science, 100(3), 183-191 (2020-10-16)
Systemic sclerosis (SSc) is characterized by excessive deposition of collagen in the skin and internal organs. Recent studies have shown that chemokine (C-X-C motif) ligands (CXCLs) are involved in the pathogenesis of SSc. Our aim was to examine the anti-fibrotic
Ching-Ju Shen et al.
PloS one, 12(3), e0174487-e0174487 (2017-03-24)
High matrix metalloproteinase 1 (MMP1) expression is associated with enhanced breast cancer growth and metastasis and also might predict poor prognosis. In this study, we further investigated the functional role of MMP1 and how it is upregulated in multi-drug resistant
Elisa Roztocil et al.
Scientific reports, 10(1), 8477-8477 (2020-05-23)
Thyroid eye disease (TED) affects 25-50% of patients with Graves' Disease. In TED, collagen accumulation leads to an expansion of the extracellular matrix (ECM) which causes destructive tissue remodeling. The purpose of this study was to investigate the therapeutic potential

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique