Direkt zum Inhalt
Merck

EMU031691

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Casp8

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGCAAATGAAATCCACGAGATTCTAGAAGGCTACCAAAGCGCAGACCACAAGAACAAAGACTGCTTCATCTGCTGTATCCTATCCCACGGTGACAAGGGTGTCGTCTATGGAACGGATGGGAAGGAGGCCTCCATCTATGACCTGACATCTTACTTCACTGGTTCAAAGTGCCCTTCCCTGTCTGGGAAACCCAAGATCTTTTTCATTCAGGCTTGCCAAGGAAGTAACTTCCAGAAAGGAGTGCCTGATGAGGCAGGCTTCGAGCAACAGAACCACACTTTAGAAGTGGATTCATCATCTCACAAGAACTATATTCCGGATGAGGCAGACTTTCTGCTGGGAATGGCTACGGTGAAGAACTGCGTTTCCTACCGAGATCCTGTGAATGGAACCTGGTATATTCAGTCACTTTGCCAGAGCCTGAGGGAAAGATGTCCTCAAGGAGATGACATTCTTAGCATCCTGACTGGCGT

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

R Coriat et al.
Cell death & disease, 2, e191-e191 (2011-08-13)
Organotellurides are newly described redox-catalyst molecules with original pro-oxidative properties. We have investigated the in vitro and in vivo antitumoral effects of the organotelluride catalyst LAB027 in a mouse model of colon cancer and determined its profile of toxicity in
Meng Yu et al.
Molecular carcinogenesis, 53(7), 505-513 (2013-01-30)
Activation of telomerase is a key element in oncogenesis and resistance to apoptosis for many cancers. Some histone deacetylase inhibitors (HDACi) or chemotheraputic agents have been reported to downregulate the expression of human telomerase reverse transcriptase (hTERT). However, whether hTERT
René Weiss et al.
Antiviral research, 123, 93-104 (2015-09-15)
New anti-viral agents and strategies are urgently needed to fight rapidly mutating viruses, as vaccine programs cannot react fast enough to prevent pandemics. Recently, we have shown that interleukin-24 (IL-24) sensitizes tumor cells to toll-like receptor 3 (TLR3) mediated apoptosis.
Kei-Ichi Ishikawa et al.
PloS one, 9(4), e94645-e94645 (2014-04-12)
Mutations in p150glued cause hereditary motor neuropathy with vocal cord paralysis (HMN7B) and Perry syndrome (PS). Here we show that both overexpression of p150glued mutants and knockdown of endogenous p150glued induce apoptosis. Overexpression of a p150glued plasmid containing either a

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.