Direkt zum Inhalt
Merck

EHU109561

Sigma-Aldrich

MISSION® esiRNA

targeting human PSMD4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GAAGGTGGCAAGATGGTGTTGGAAAGCACTATGGTGTGTGTGGACAACAGTGAGTATATGCGGAATGGAGACTTCTTACCCACCAGGCTGCAGGCCCAGCAGGATGCTGTCAACATAGTTTGTCATTCAAAGACCCGCAGCAACCCTGAGAACAACGTGGGCCTTATCACACTGGCTAATGACTGTGAAGTGCTGACCACACTCACCCCAGACACTGGCCGTATCCTGTCCAAGCTACATACTGTCCAACCCAAGGGCAAGATCACCTTCTGCACGGGCATCCGCGTGGCCCATCTGGCTCTGAAGCACCGACAAGGCAAGAATCACAAGATGCGCATCATTGCCTTTGTGGGAAGCCCAGTGGAGGACAATGAGAAGGATCTGGTGAAACTGGCTAAACGCCTCAAGA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Verwandte Kategorien

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

WGK

WGK 1

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Pere Dosta et al.
Cardiovascular engineering and technology, 12(1), 114-125 (2021-01-22)
Endothelial cell (EC) dysfunction underlies the pathology of multiple disease conditions including cardiovascular and pulmonary diseases. Dysfunctional ECs have a distinctive gene expression profile compared to healthy ECs. RNAi therapy is a powerful therapeutic approach that can be used to
Ai-Guo Ma et al.
The Kaohsiung journal of medical sciences, 35(10), 591-597 (2019-06-05)
Proteasome 26S subunit non-ATPase 4 (PSMD4) is an important proteasome ubiquitin receptor and plays a key role in endoplasmic reticulum stress (ERS). However, the study of PSMD4 in esophageal cancer (EC) is relatively rare. Here, we found that the expression
Emma-Kate Loveday et al.
The Journal of general virology, 96(Pt 1), 30-39 (2014-09-23)
A common critical cellular event that many human enveloped viruses share is the requirement for proteolytic cleavage of the viral glycoprotein by furin in the host secretory pathway. For example, the furin-dependent proteolytic activation of highly pathogenic (HP) influenza A
Lin Wang et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 22(12), 1079-1087 (2015-11-10)
Dihydrotanshinone I (DHTS) was previously reported to exhibit the most potent anti-cancer activity among several tanshinones in colon cancer cells. Its cytotoxic action was reactive oxygen species (ROS) dependent but p53 independent. To further study the anti-cancer activity of DHTS
T P H Nguyen et al.
Journal of molecular medicine (Berlin, Germany), 93(7), 795-805 (2015-02-27)
Fetal growth restriction (FGR) affects up to 5 % of pregnancies worldwide, and trophoblast function plays a significant role on the outcome. An epidemiological study has linked vitamin D deficiency to adverse perinatal outcomes, which include decreased birth weight. The

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.