Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EMU091061

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rbpj

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCTATGGCAACAGCGATGACATTGGTGTGTTCCTCAGCAAGCGGATAAAGGTCATCTCCAAACCCTCCAAAAAGAAGCAGTCACTGAAGAATGCTGACTTGTGCATTGCTTCAGGAACGAAGGTGGCACTGTTCAATCGCCTTCGGTCCCAGACAGTTAGTACCAGGTACCTGCATGTAGAAGGAGGGAATTTCCACGCCAGTTCACAACAGTGGGGAGCATTTTACATCCATCTCTTGGACGACGACGAGTCGGAAGGAGAGGAGTTCACAGTTAGAGATGGCTACATCCATTACGGGCAGACTGTCAAGCTTGTGTGCTCAGTGACTGGCATGGCACTCCCAAGATTGATAATTAGGAAAGTTGATAAGCAGACGGCATTACTGGATGCAGACGACCCTGTAT

Numéro d'accès Ensembl | souris

ENSMUSG00000039191

Numéro d'accès NCBI

NM_001080927

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... RBPJ(19664) , Rbpj(19664)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

12 - Non Combustible Liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hideya Onishi et al.
Cancer letters, 371(2), 143-150 (2015-12-15)
We previously demonstrated that Hedgehog (Hh) signaling is activated under hypoxia through upregulation of transcription of Smoothened (SMO) gene. However, the mechanism of hypoxia-induced activation of SMO transcription remains unclear. In the analysis of altered expressions of genes related to
M Tanaka et al.
British journal of cancer, 100(12), 1957-1965 (2009-05-21)
The study shows constitutive activation of the Notch pathway in various types of malignancies. However, it remains unclear how the Notch pathway is involved in the pathogenesis of osteosarcoma. We investigated the expression of the Notch pathway molecules in osteosarcoma
Hiroko Nagao et al.
PloS one, 7(7), e39268-e39268 (2012-07-14)
The Notch pathway regulates a broad spectrum of cell fate decisions and differentiation processes during fetal and postnatal development. In addition, the Notch pathway plays an important role in controlling tumorigenesis. However, the role of RBPJ, a transcription factor in
Robert J Lake et al.
PLoS genetics, 10(3), e1004204-e1004204 (2014-03-08)
Mechanisms that maintain transcriptional memory through cell division are important to maintain cell identity, and sequence-specific transcription factors that remain associated with mitotic chromatin are emerging as key players in transcriptional memory propagation. Here, we show that the major transcriptional
Hirokuni Akahori et al.
Nature communications, 6, 7792-7792 (2015-08-06)
Macrophages are an essential component of the immune response to ischaemic injury and play an important role in promoting inflammation and its resolution, which is necessary for tissue repair. The type I transmembrane glycoprotein CD163 is exclusively expressed on macrophages

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique