Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EMU048301

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ppfibp1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAAGACCTGCGTGGATTGTTGGAGATGATGGAAACGGATGAGAAGGAAGGATTGAGATGCCAGATCCCAGATTCAACAGCAGAAGTGCTTATTGAGTGGCTTCAAAATCAAATGACAAATGGACATCTACCTGGGAATGGAGATGTGTATCAAGAAAGGTTGGCACGTCTAGAAAACGACAAGGAATCCCTCGTTCTTCAGGTAAGTGTGTTGACAGACCAGGTGGAGGCTCAGGGAGAGAAGATTCGGGATTTGGAGTTCTGTCTTGAAGAGCACAGAGAGAAGCTGAATGCCACTGAAGAAATGCTGCAGCAGGAGCTTCTGAGTAGGACCTCCTTAGAGACACAGAAGCTGGAGCTGATGGCTGAGATCTCTAACTTGAAGTTAAAACTGACGGCCGTAGAGAAGGACAGGCTG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mieke W H Roeven et al.
Journal of immunotherapy (Hagerstown, Md. : 1997), 38(4), 145-154 (2015-04-04)
Dendritic cell (DC)-based vaccination is an appealing strategy to boost graft-versus-tumor immunity after allogeneic stem cell transplantation (allo-SCT), and thereby prevent or counteract tumor recurrence. By exploiting minor histocompatibility antigens (MiHA) presented on hematopoietic cells, donor CD8 T-cell immunity can
Mahdi Mojallal et al.
Nature communications, 5, 4557-4557 (2014-08-02)
The establishment and maintenance of apical-basal cell polarity is essential for the functionality of glandular epithelia. Cell polarity is often lost in advanced tumours correlating with acquisition of invasive and malignant properties. Despite extensive knowledge regarding the formation and maintenance

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique