Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EMU037611

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Twist1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACGAGCTGGACTCCAAGATGGCAAGCTGCAGCTATGTGGCCCACGAGCGGCTCAGCTACGCCTTCTCCGTCTGGAGGATGGAGGGGGCCTGGTCCATGTCCGCGTCCCACTAGCAGCGGAGCTCCCCACCCCCTCTGCAGGCCGGAGACCTAGATGTCATTGTTTCCAGAGAAGGAGAAAATGGACAGTCTAGAGACTCTGGAGCTGGATAACTAAAAATAAATCTATATGACAAAGATTTTCATGGAAATTAGAAGAGCAGAGACCAAATTCACAAGAATCAGGGCGTGGGGCACACTTTTAAAAGAGAAAGCGAGACAGGCCCGTGGACAGAGATTCCCAGAGGGGCAGCAGCAGACCCCCCACACCTCTGCATTCTGATAGAAGTCTGAACACTCGTTTGTGTCCCCCCACCCCACTTTTTGACGAAGAATGTTTTATTTTTATTTTTCATGCATGCATTCTCAAGAGGTCTTGCCAATCAGCCACTGACAGGAA

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shasha Zheng et al.
Journal of immunology (Baltimore, Md. : 1950), 195(1), 217-226 (2015-05-29)
Proper regulation of microbial-induced cytokines is critical to intestinal immune homeostasis. Acute stimulation of nucleotide-binding oligomerization domain 2 (NOD2), the Crohn's disease-associated sensor of bacterial peptidoglycan, induces cytokines. However, chronic NOD2 stimulation in macrophages decreases cytokines upon pattern recognition receptor
Rosemarie Chirco D'Angelo et al.
Molecular cancer research : MCR, 12(9), 1324-1333 (2014-06-05)
Tissue inhibitor of metalloproteinase-1 (TIMP-1) regulates intracellular signaling networks for inhibition of apoptosis. Tetraspanin (CD63), a cell surface binding partner for TIMP-1, was previously shown to regulate integrin-mediated survival pathways in the human breast epithelial cell line MCF10A. In the
Lihua Yang et al.
Scientific reports, 5, 13677-13677 (2015-09-04)
Understanding the molecular mechanism by which epithelial mesenchymal transition (EMT)-mediated cancer metastasis and how microRNA (miRNA) regulates lung cancer progression via Twist1-activated EMT may provide potential therapeutic targets for cancer therapy. Here we found that miR-33a, an intronic miRNA located

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique