Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU129801

Sigma-Aldrich

MISSION® esiRNA

targeting human PRSS12

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTCACAGCAGCACACTGTTTCAAGAGGTATGGCAACAGCACTAGGAGCTATGCTGTTAGGGTTGGAGATTATCATACTCTGGTACCAGAGGAGTTTGAGGAAGAAATTGGAGTTCAACAGATTGTGATTCATCGGGAGTATCGACCCGACCGCAGTGATTATGACATAGCCCTGGTTAGATTACAAGGACCAGAAGAGCAATGTGCCAGATTCAGCAGCCATGTTTTGCCAGCCTGTTTACCACTCTGGAGAGAGAGGCCACAGAAAACAGCATCCAACTGTTACATAACAGGATGGGGTGACACAGGACGAGCCTATTCAAGAACACTACAACAAGCAGCCATTCCCTTACTTCCTAAAAGGTTTTGTGAAGAACGTTATAAGGGTCGGTTTACAGGGAGAATGCTTTGTGCTGGAAACCTCCATGAACACAAACGCGTGGACAGCTGCCAGGGAGACAGCGGAGGACCACTCATGTGTGAACGGCCCGGAGAGAGCTGGGTGGTGTATGGGGTGACCTC

Numéro d'accès Ensembl | humain

ENSG00000164099

Numéro d'accès NCBI

NM_003619

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PRSS12(8492) , PRSS12(8492)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ah-Rong Nam et al.
Cancer research and treatment : official journal of Korean Cancer Association, 51(3), 886-900 (2018-10-05)
Jab1 is a coactivator of c-Jun that enhances the transcriptional function of c-Jun. Jab1 is frequently overexpressed in various cancers and is associatedwith poor prognosis of cancer patients. Thus, Jab1 could be a potential therapeutic target in cancer. However, the
Judit Iván et al.
Stem cells and development, 26(23), 1724-1733 (2017-10-11)
Free fatty acid receptor 2 (FFAR2, also known as GPR43) is a G-protein-coupled receptor activated by short-chain fatty acids that are produced by gut microbiota through fermentation of nondigestible carbohydrates. FFAR2 functions as a metabolic sensor and is expressed in
J J Souchek et al.
British journal of cancer, 111(6), 1139-1149 (2014-07-16)
Despite its promise as a highly useful therapy for pancreatic cancer (PC), the addition of external beam radiation therapy to PC treatment has shown varying success in clinical trials. Understanding PC radioresistance and discovery of methods to sensitise PC to
Yang Zhang et al.
American journal of physiology. Lung cellular and molecular physiology, 307(2), L173-L185 (2014-05-20)
The inflammatory response is a primary mechanism in the pathogenesis of ventilator-induced lung injury. Autophagy is an essential, homeostatic process by which cells break down their own components. We explored the role of autophagy in the mechanisms of mechanical ventilation-induced
Shun-Yao Ko et al.
PloS one, 9(10), e110542-e110542 (2014-10-21)
Advanced glycation end products (AGEs) are produced in an irreversible non-enzymatic reaction of carbohydrates and proteins. Patients with diabetes mellitus (DM) are known to have elevated AGE levels, which is viewed as a risk factor of diabetes-related complications. In a
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique