Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU120081

Sigma-Aldrich

MISSION® esiRNA

targeting human ORAI1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCGGCCTGATCTTTATCGTCTTCGCCGTCCACTTCTACCGCTCACTGGTTAGCCATAAGACTGACCGACAGTTCCAGGAGCTCAACGAGCTGGCGGAGTTTGCCCGCTTACAGGACCAGCTGGACCACAGAGGGGACCACCCCCTGACGCCCGGCAGCCACTATGCCTAGGCCCATGTGGTCTGGGCCCTTCCAGTGCTTTGGCCTTACGCCCTTCCCCTTGACCTTGTCCTGCCCCAGCCTCACGGACAGCCTGCGCAGGGGGCTGGGCTTCAGCAAGGGGCAGAGCATGGAGGGAAGAGGATTTTTATAAGAGAAATTTCTGCACTTTGAAACTGTCCTCTAAGAGAATAAGCATTTCCTGTTCTTCCAGCTCCAGGTCCACCTCCTGTTGGGAGGCGGTGGGGGGCCAAAGTGGGGCCACACACTCGCTGTGTCCCCTCTCCTCCCCTGTGCCAGTGCCACCTGGGTGCCTCCTCCTGTCCTGTCCGTCTCAACCTC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ke Ma et al.
Journal of molecular medicine (Berlin, Germany), 97(10), 1465-1475 (2019-08-07)
Compromised renal phosphate elimination in chronic kidney disease (CKD) leads to hyperphosphatemia, which in turn triggers osteo-/chondrogenic signaling in vascular smooth muscle cells (VSMCs) and vascular calcification. Osteo-/chondrogenic transdifferentiation of VSMCs leads to upregulation of the transcription factors MSX2, CBFA1
Franz Ewendt et al.
Pflugers Archiv : European journal of physiology, 472(4), 503-511 (2020-03-20)
Bone cells secrete fibroblast growth factor 23 (FGF23), a hormone that inhibits the synthesis of active vitamin D (1,25(OH)2D3) and induces phosphate excretion in the kidney. In addition, it exerts paracrine effects on other cells including hepatocytes, cardiomyocytes, and immune
Shuang Liu et al.
Immunology and cell biology, 92(9), 752-760 (2014-06-18)
The regulated control of Ca(2+) influx is essential for the activation and function of the adaptive immune response, as Ca(2+) is a key regulator of important transcription factors. To determine whether Ca(2+) release-activated Ca(2+) (CRAC) channels contribute to the abnormal
Deng He et al.
International journal of molecular sciences, 16(7), 16313-16329 (2015-07-21)
The molecular events leading to nephrolithiasis are extremely complex. Previous studies demonstrated that calcium and transforming growth factor-β1 (TGF-β1) may participate in the pathogenesis of stone formation, but the explicit mechanism has not been defined. Using a self-created genetic hypercalciuric
Jingsheng Xia et al.
The Journal of physiology, 592(16), 3443-3461 (2014-05-27)
Store-operated calcium channels (SOCs) are calcium-selective cation channels that mediate calcium entry in many different cell types. Store-operated calcium entry (SOCE) is involved in various cellular functions. Increasing evidence suggests that impairment of SOCE is responsible for numerous disorders. A

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique