Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU048931

Sigma-Aldrich

MISSION® esiRNA

targeting human PIM2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGGCATCCTCCTCTATGACATGGTGTGTGGGGACATTCCCTTTGAGAGGGACCAGGAGATTCTGGAAGCTGAGCTCCACTTCCCAGCCCATGTCTCCCCAGACTGCTGTGCCCTAATCCGCCGGTGCCTGGCCCCCAAACCTTCTTCCCGACCCTCACTGGAAGAGATCCTGCTGGACCCCTGGATGCAAACACCAGCCGAGGATGTACCCCTCAACCCCTCCAAAGGAGGCCCTGCCCCTTTGGCCTGGTCCTTGCTACCCTAAGCCTGGCCTGGCCTGGCCTGGCCCCCAATGGTCAGAAGAGCCATCCCATGGCCATGTCACAGGGATAGATGGACATTTGTTGACTTGGTTTTACAGGTCATTACCAGTCATTAAAGTCCAGTATTACTAAGGTAAGGGATTGAGGATCAGGGGTTAGAAGACATAAACCAAGTCTGCCCAGTTCCCTTC

Numéro d'accès Ensembl | humain

ENSG00000102096

Numéro d'accès NCBI

NM_006875

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PIM2(11040) , PIM2(11040)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

J R Nair et al.
Leukemia, 31(8), 1715-1726 (2016-12-23)
The PIM kinase family (PIM1, 2 and 3) have a central role in integrating growth and survival signals, and are expressed in a wide range of solid and hematological malignancies. We now confirm that PIM2 is overexpressed in multiple myeloma
Tingting Yang et al.
Oncogene, 37(45), 5997-6009 (2018-07-10)
Hexokinase-II (HK2) is a key enzyme involved in glycolysis, which is required for breast cancer progression. However, the underlying post-translational mechanisms of HK2 activity are poorly understood. Here, we showed that Proviral Insertion in Murine Lymphomas 2 (PIM2) directly bound
Zhaoyun Liu et al.
Oncology letters, 17(6), 5395-5402 (2019-06-13)
PIM2 proto-oncogene, serine/threonine kinase (PIM2) is a serine/threonine protein kinase that is upregulated in different types of cancer and serves essential roles in the regulation of signal transduction cascades, which promote cell survival and cell proliferation. The present study demonstrated
Chune Ren et al.
Molecular oncology, 12(5), 690-704 (2018-03-24)
Tristetraprolin (TTP) is an AU-rich element-binding protein that regulates mRNA stability and plays important roles in cancer. The mechanisms by which TTP is regulated in breast cancer are poorly understood. Using multiple biochemical approaches, we found that proviral insertion in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique