Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EMU005581

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Timp1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CGAATCAACGAGACCACCTTATACCAGCGTTATAAGATCAAGATGATGACTAAGATGCTAAAAGGATTCAAGGCTGTGGGAAATGCCGCAGATATCCGGTACGCCTACACCCCAGTCATGGAAAGCCTCTGTGGATATGCCCACAAGTCCCAGAACCGCAGTGAAGAGTTTCTCATCACGGGCCGCCTAAGGAACGGGAAATTTCACATCAATGCCTGCAGCTTCTTGGTTCCCTGGCGTACTCTGAGCCCTGCTCAGCAAAGAGTTTTCTCAAAAAAGAACTATAGTGCTGGCTGTGGGGTGTGCACAGTGTTTCCCTGTTTATCTATCCCTTGCAAACTGGAGAGTGACACTCACTGTTTGTGGACGGATCAGGTCCTCGTGGGCTCTGAGGACTACCAGAGCCGTC

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... Timp1(21857)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xiujuan Yao et al.
Respirology (Carlton, Vic.), 20(5), 730-738 (2015-05-02)
Interleukin (IL)-25 has been implicated in the pathogenesis of human asthma by inducing a Th2 cytokine response, but its possible role in the development of airway remodelling is less clear. We developed a murine surrogate of chronic airway inflammation induced
Rosemarie Chirco D'Angelo et al.
Molecular cancer research : MCR, 12(9), 1324-1333 (2014-06-05)
Tissue inhibitor of metalloproteinase-1 (TIMP-1) regulates intracellular signaling networks for inhibition of apoptosis. Tetraspanin (CD63), a cell surface binding partner for TIMP-1, was previously shown to regulate integrin-mediated survival pathways in the human breast epithelial cell line MCF10A. In the
Robert Ramer et al.
Biochemical pharmacology, 91(2), 202-216 (2014-07-01)
Cannabinoids inhibit tumor neovascularization as part of their tumorregressive action. However, the underlying mechanism is still under debate. In the present study the impact of cannabinoids on potential tumor-to-endothelial cell communication conferring anti-angiogenesis was studied. Cellular behavior of human umbilical

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica