Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU151571

Sigma-Aldrich

MISSION® esiRNA

targeting human TWIST1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CGGACAAGCTGAGCAAGATTCAGACCCTCAAGCTGGCGGCCAGGTACATCGACTTCCTCTACCAGGTCCTCCAGAGCGACGAGCTGGACTCCAAGATGGCAAGCTGCAGCTATGTGGCTCACGAGCGGCTCAGCTACGCCTTCTCGGTCTGGAGGATGGAGGGGGCCTGGTCCATGTCCGCGTCCCACTAGCAGGCGGAGCCCCCCACCCCCTCAGCAGGGCCGGAGACCTAGATGTCATTGTTTCCAGAGAAGGAGAAAATGGACAGTCTAGAGACTCTGGAGCTGGATAACTAAAAATAAAAATATATGCCAAAGATTTTCTTGGAAATTAGAAGAGCAAAATCCAAATTCAAAGAAACAGGGCGTGGGGCGCACTTTTAAAAGAGAAAGCGAGACAGGCCCGTGGACAGTGATTCCCAGACGGGCAGCGGCACCATCCTCACACCTCTGCATTCTG

Ensembl | Número de adesão de ser humano

ENSG00000122691

nº de adesão NCBI

NM_000474

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... TWIST1(7291) , TWIST1(7291)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

W Liu et al.
European review for medical and pharmacological sciences, 21(17), 3787-3793 (2017-10-05)
Endometrial carcinoma is the most common malignancy of the female genital tract. Therefore, there is an urgent need to understand the molecular mechanism of its metastasis. This study is aimed to explore the function and underlying mechanism of miR-326 in
Wei Li et al.
Oncology reports, 37(1), 185-192 (2016-11-24)
High expression of high mobility group protein A2 (HMGA2) is correlated with the invasiveness of gastric cancer and is an independent prognostic factor. The reason may be that HMGA2 promotes epithelial-mesenchymal transition (EMT) and the acquisition of tumor stem cell properties, yet
Yutian Wang et al.
Frontiers in microbiology, 11, 1301-1301 (2020-07-01)
Staphylococcus aureus (S. aureus) infection-induced osteomyelitis is a great challenge in clinic treatment. Identification of the essential genes and biological processes that are specifically changed in mononuclear cells at an early stage of S. aureus osteomyelitis is of great clinical
Mairéad A Cleary et al.
Stem cells and development, 26(10), 751-761 (2017-03-17)
Human bone marrow-derived mesenchymal stem cells (BMSCs) are clinically promising to repair damaged articular cartilage. This study investigated TWIST1, an important transcriptional regulator in mesenchymal lineages, in BMSC chondrogenesis. We hypothesized that downregulation of TWIST1 expression is required for in
Cai M Roberts et al.
Scientific reports, 6, 37652-37652 (2016-11-24)
Epithelial ovarian cancer (EOC) is the most deadly gynaecologic malignancy due to late onset of symptoms and propensity towards drug resistance. Epithelial-mesenchymal transition (EMT) has been linked to the development of chemoresistance in other cancers, yet little is known regarding
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica