Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU098591

Sigma-Aldrich

MISSION® esiRNA

targeting human LRRK2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CTCACGAGCTTTCCACAACAGCTATGTGAAACTCTGAAGAGTTTGACACATTTGGACTTGCACAGTAATAAATTTACATCATTTCCTTCTTATTTGTTGAAAATGAGTTGTATTGCTAATCTTGATGTCTCTCGAAATGACATTGGACCCTCAGTGGTTTTAGATCCTACAGTGAAATGTCCAACTCTGAAACAGTTTAACCTGTCATATAACCAGCTGTCTTTTGTACCTGAGAACCTCACTGATGTGGTAGAGAAACTGGAGCAGCTCATTTTAGAAGGAAATAAAATATCAGGGATATGCTCCCCCTTGAGACTG

Ensembl | Número de adesão de ser humano

ENSG00000188906

nº de adesão NCBI

NM_198578

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... LRRK2(120892) , LRRK2(120892)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ji-Hye Yoon et al.
Biochimica et biophysica acta, 1864(12), 2356-2368 (2017-09-11)
Leucine-rich repeat kinase 2 (LRRK2), a multi-domain protein, is a key causative factor in Parkinson's disease (PD). Identification of novel substrates and the molecular mechanisms underlying the effects of LRRK2 are essential for understanding the pathogenesis of PD. In this
Zhongcan Chen et al.
Human molecular genetics, 26(22), 4494-4505 (2017-10-04)
Pathogenic leucine-rich repeat kinase 2 (LRRK2) mutations are recognized as the most common cause of familial Parkinson's disease in certain populations. Recently, LRRK2 mutations were shown to be associated with a higher risk of hormone-related cancers. However, how LRRK2 itself
Xiaodong Ding et al.
Neurobiology of disease, 98, 122-136 (2016-11-29)
Dominantly inherited mutations in leucine-rich repeat kinase 2 (LRRK2) are the most common causes of familial Parkinson's disease (PD) and LRRK2 polymorphisms are associated with increased risk for idiopathic PD. However, the molecular mechanisms by which these mutations cause PD
Alexia F Kalogeropulou et al.
The Biochemical journal, 477(22), 4397-4423 (2020-11-03)
Mutations that enhance LRRK2 protein kinase activity cause inherited Parkinson's disease. LRRK2 phosphorylates a group of Rab GTPase proteins, including Rab10 and Rab12, within the effector-binding switch-II motif. Previous work has indicated that the PARK16 locus, which harbors the gene
Fieke Wauters et al.
Autophagy, 16(2), 203-222 (2019-04-05)
Parkinson disease (PD) is a disabling, incurable disorder with increasing prevalence in the western world. In rare cases PD is caused by mutations in the genes for PINK1 (PTEN induced kinase 1) or PRKN (parkin RBR E3 ubiquitin protein ligase)

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica