Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU072801

Sigma-Aldrich

MISSION® esiRNA

targeting human GIPC1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

ATCGACCACATCCACCTCATCAGCGTGGGCGACATGATCGAGGCCATTAACGGGCAGAGCCTGCTGGGCTGCCGGCACTACGAGGTGGCCCGGCTGCTCAAGGAGCTGCCCCGAGGCCGTACCTTCACGCTGAAGCTCACGGAGCCTCGCAAGGCCTTCGACATGATCAGCCAGCGTTCAGCGGGTGGCCGCCCTGGCTCTGGCCCACAACTGGGCACTGGCCGAGGGACCCTGCGGCTCCGATCCCGGGGCCCCGCCACGGTGGAGGATCTGCCCTCTGCCTTTGAAGAGAAGGCCATTGAGAAGGTGGATGACCTGCTGGAGAGTTACATGGGTATCAGGGACACGGAGCTGGCGGCCACCATGGTGGAGCTGGGAAAGGACAAAAGGAACCCGGATGAGCTGGCCGAGGCCCTGGACGAACGGCTGGGTGACTTTGCCTTCCCTGAC

Ensembl | Número de adesão de ser humano

ENSG00000123159

nº de adesão NCBI

NM_005716

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... GIPC1(10755) , GIPC1(10755)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ling Wang et al.
PloS one, 2(11), e1161-e1161 (2007-11-15)
Vascular permeability factor/vascular endothelial growth factor (VPF/VEGF), one of the crucial pro-angiogenic factors, functions as a potent inhibitor of endothelial cell (EC) apoptosis. Previous progress has been made towards delineating the VPF/VEGF survival signaling downstream of the activation of VEGFR-2.
Guilong Zhang et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(10), 13777-13788 (2016-08-03)
Glioma occurs due to multi-gene abnormalities. Neuropilin-1 (NRP-1), as a transmembrane protein, involves in glioma proliferation, invasion, and migration, as well as tumor angiogenesis. The cytoplasmic protein, GAIP/RGS19-interacting protein (GIPC1), could regulate the clathrin-vesicles trafficking and recycling. Here, we show
Xiuping Huang et al.
Nature communications, 10(1), 3708-3708 (2019-08-20)
Neuropilin-1 (NRP1) is an essential transmembrane receptor with a variety of cellular functions. Here, we identify two human NRP1 splice variants resulting from the skipping of exon 4 and 5, respectively, in colorectal cancer (CRC). Both NRP1 variants exhibit increased
Ayumi Yoshida et al.
Biology open, 4(9), 1063-1076 (2015-07-26)
Neuropilin-1 (NRP1) has been identified as a VEGF-A receptor. DJM-1, a human skin cancer cell line, expresses endogenous VEGF-A and NRP1. In the present study, the RNA interference of VEGF-A or NRP1 suppressed DJM-1 cell proliferation. Furthermore, the overexpression of
Santanu Bhattacharya et al.
PloS one, 9(12), e114409-e114409 (2014-12-04)
GAIP interacting protein C terminus (GIPC) is known to play an important role in a variety of physiological and disease states. In the present study, we have identified a novel role for GIPC as a master regulator of autophagy and

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica