Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU054581

Sigma-Aldrich

MISSION® esiRNA

targeting human SND1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCCATTGTTGTGAAGCTGAACTCAGGCGATTACAAGACGATTCACCTGTCCAGCATCCGACCACCGAGGCTGGAGGGGGAGAACACCCAGGATAAGAACAAGAAACTGCGTCCCCTGTATGACATTCCTTACATGTTTGAGGCCCGGGAATTTCTTCGAAAAAAGCTTATTGGGAAGAAGGTCAATGTGACGGTGGACTACATTAGACCAGCCAGCCCAGCCACAGAGACAGTGCCTGCCTTTTCAGAGCGTACCTGTGCCACTGTCACCATTGGAGGAATAAACATTGCTGAGGCTCTTGTCAGCAAAGGTCTAGCCACAGTGATCAGATACCGGCAGGATGATGACCAGAGATCATCACACTACGATGAACTGCTTGCTGCAGAGGCCAGAGCTATTAAGAATGGCAAAGGATTGCATAGCAAGAAGGAAGTGCCTATCCACCGTGT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

12 - Non Combustible Liquids

Classe de risco de água (WGK)

WGK 1

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Huining Li et al.
Oncotarget, 8(12), 19723-19737 (2017-02-06)
miR-320a downexpression contributes to tumorigenesis in several human cancers. However, the relevance of miR-320a to prognosis, proliferation and invasion in gliomas remains unclear. In this study, we demonstrated that miR-320a expression was decreased in human glioma tissues and cell lines.
Yongqiang Zhang et al.
Oncology letters, 15(6), 9553-9558 (2018-05-29)
Glioma is one of the malignant tumor types detrimental to human health; therefore, it is important to find novel targets and therapeutics for this tumor. The downregulated expression of Tudor-staphylococcal nuclease (SN) and alkylglycerone phosphate synthase (AGPS) can decrease cancer
Fei Ma et al.
Oncotarget, 6(19), 17404-17416 (2015-05-13)
MicroRNAs (miRs) function as key regulators of gene expression and their deregulation is associated with the carcinogenesis of various cancers. In the present study, we investigated the biological role and mechanism of miR-361-5p in colorectal carcinoma (CRC) and gastric cancer

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica