Skip to Content
Merck
All Photos(1)

Key Documents

EHU109701

Sigma-Aldrich

MISSION® esiRNA

targeting human HSP90B1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGGTGTGGTGGACTCAGATGATCTCCCCTTGAATGTTTCCCGCGAGACTCTTCAGCAACATAAACTGCTTAAGGTGATTAGGAAGAAGCTTGTTCGTAAAACGCTGGACATGATCAAGAAGATTGCTGATGATAAATACAATGATACTTTTTGGAAAGAATTTGGTACCAACATCAAGCTTGGTGTGATTGAAGACCACTCGAATCGAACACGTCTTGCTAAACTTCTTAGGTTCCAGTCTTCTCATCATCCAACTGACATTACTAGCCTAGACCAGTATGTGGAAAGAATGAAGGAAAAACAAGACAAAATCTACTTCATGGCTGGGTCCAGCAGAAAAGAGGCTGAATCTTCTCCATTTGTTGAGCGACTTCTGAAAAAGGGCTATGAAGTTATTTACCTCACAGAACCTGTGGATGAATACTGTATTCAGGCCCTTCCCGAATTTGATGGGAAGAGGTTCCAG

Ensembl | human accession no.

ENSG00000166598

NCBI accession no.

NM_003299

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... HSP90B1(7184) , HSP90B1(7184)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Pedro Buc Calderon et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 105, 115-120 (2018-06-01)
Grp94 plays an essential role in protein assembly. We previously suggested that Grp94 overexpression is involved in tumor aggressiveness. However, the underlying mechanisms remain unknown. Since many tumors display high Grp94 levels, we investigated the effects of tumor microenvironment on
Qun Wei et al.
Biochemical and biophysical research communications, 511(1), 92-98 (2019-02-17)
Vascular endothelial cell (VEC) apoptosis takes part in the development of various cardiovascular diseases. Heat shock protein 90 (HSP90) regulates apoptosis through various apoptosis associated client proteins. In previous study, we identified a novel HSP90 inhibitor HCP1 induced apoptosis in
Naiara Santana-Codina et al.
International journal of molecular sciences, 20(16) (2019-08-10)
Metabolic adaptation may happen in response to the pressure exerted by the microenvironment and is a key step in survival of metastatic cells. Brain metastasis occurs as a consequence of the systemic dissemination of tumor cells, a fact that correlates
Sha She et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 48(2), 741-752 (2018-07-20)
C reactive protein (CRP) levels are elevated in many diseases, including malignant tumors and cardiovascular disorders. In this study, the protein interaction network for CRP was evaluated to determine the importance of CRP and its interacting proteins in the molecular
Lipeng Xiong et al.
Journal of proteomics, 182, 34-44 (2018-05-08)
A Disintegrin And Metalloproteinase 12 (ADAM12) is highly expressed in multiple cancers such as breast and cervical cancers and its high expression reduces the overall patient survival rate. ADAM12 has two major splicing variants, the long membrane-anchored form ADAM12L and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service