Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU071731

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mta1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGCCAAAGTGGTGTGTTTCTACAGAAGGCGGGACATTTCCAGCAGCCTCATCGCGCTGGCGGACAAGCATGCAAGGGAAGTGGAGGAGGAGGTAGAAAACCCAGAGATGGTGGACCTGCCTGAGAAACTTAAGCATCAGCTGCGGCATCGAGAACTGTTCCTGTCTCGGCAGTTGGAGTCTCTGCCTGCCACCCACATCAGGGGCAAGTGCAGTGTTACCCTGCTCAATGAGACGGAGTCACTCAAGTCCTACTTGGAGCGTGAGGATTTCTTCTTCTACTCTCTAGTCTACGACCCACAGCAGAAGACCCTCCTGGCTGATAAAGGGGAAATTCGTGTAGGAAACCGGTACCAGGCTGACATCACTGACTTGCTGAAAGAAGGTGAGGAGGACGGCCGCGATCAGTCAAAACTGGAGACCAAGGTGTGG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

12 - Non Combustible Liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wenhao Weng et al.
International journal of oncology, 44(3), 812-818 (2014-01-16)
Esophageal squamous cell carcinoma (ESCC) is one of the most common malignant tumors. Upregulation of metastasis-associated protein 1 (MTA1) has been reported to contribute to the development of esophageal squamous cell carcinoma. Therefore, the objective of our study was to identify
Hong Zhang et al.
Acta biochimica et biophysica Sinica, 47(7), 496-503 (2015-05-23)
Metastasis-associated gene 1 (MTA1) is associated with cell growth, metastasis, and survival in non-small-cell lung cancer (NSCLC). Several previous reports have demonstrated that microRNAs affect gene expression through interaction between their seed region and the 3'-untranslated region of the target

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique