Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU122601

Sigma-Aldrich

MISSION® esiRNA

targeting human TP63

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AACAGCCATGCCCAGTATGTAGAAGATCCCATCACAGGAAGACAGAGTGTGCTGGTACCTTATGAGCCACCCCAGGTTGGCACTGAATTCACGACAGTCTTGTACAATTTCATGTGTAACAGCAGTTGTGTTGGAGGGATGAACCGCCGTCCAATTTTAATCATTGTTACTCTGGAAACCAGAGATGGGCAAGTCCTGGGCCGACGCTGCTTTGAGGCCCGGATCTGTGCTTGCCCAGGAAGAGACAGGAAGGCGGATGAAGATAGCATCAGAAAGCAGCAAGTTTCGGACAGTACAAAGAACGGTGATGGTACGAAGCGCCCGTTTCGTCAGAACACACATGGTATCCAGATGACATCCATCAAGAAACGAAGATCCCCAGATGATGAACTGTTATACTTACCAGTGAGGGGCCGTGAGACTTATGAAATGCTGTTGAAGATCAAAGAGTCCCTGGAACTCATGCAGTACCTTCCTCAGCACACAATTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Swarnabh Bhattacharya et al.
Stem cells (Dayton, Ohio), 37(3), 417-429 (2018-12-15)
Mutations in key transcription factors SOX2 and P63 were linked with developmental defects and postnatal abnormalities such as corneal opacification, neovascularization, and blindness. The latter phenotypes suggest that SOX2 and P63 may be involved in corneal epithelial regeneration. Although P63
Shuai Ye et al.
International journal of oncology, 44(6), 2153-2159 (2014-04-11)
p63 is a member of the p53 protein family and plays a crucial role in epithelial development. p63 is expressed in many types of tumors including esophageal cancer; however, its function in cancer is controversial and its role in esophageal
Hulda R Jonsdottir et al.
Laboratory investigation; a journal of technical methods and pathology, 95(12), 1418-1428 (2015-09-22)
Idiopathic pulmonary fibrosis (IPF) is a progressive interstitial lung disease with high morbidity and mortality. The cellular source of the fibrotic process is currently under debate with one suggested mechanism being epithelial-to-mesenchymal transition (EMT) in the alveolar region. In this

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique