Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU069931

Sigma-Aldrich

MISSION® esiRNA

targeting human BTRC

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGCTGTGCCAGACTCTGCTTAAACCAAGAAACAGTATGTTTAGCAAGCACTGCTATGAAGACTGAGAATTGTGTGGCCAAAACAAAACTTGCCAATGGCACTTCCAGTATGATTGTGCCCAAGCAACGGAAACTCTCAGCAAGCTATGAAAAGGAAAAGGAACTGTGTGTCAAATACTTTGAGCAGTGGTCAGAGTCAGATCAAGTGGAATTTGTGGAACATCTTATATCCCAAATGTGTCATTACCAACATGGGCACATAAACTCGTATCTTAAACCTATGTTGCAGAGAGATTTCATAACTGCTCTGCCAGCTCGGGGATTGGATCATATTGCTGAGAACATTCTGTCATACCTGGATGCCAAATCACTATGTGCTGCTGAACTTGTGTGCAAGGAATGGTACCGAGTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Kazunori Hashimoto et al.
Antioxidants & redox signaling, 25(17), 953-964 (2016-06-02)
Nuclear factor erythroid 2 (NF-E2)-related factor 2 (Nrf2) is the master transcriptional regulator of antioxidant gene expression. On increased oxidative stress, an adaptor for Nrf2 degradation, Kelch-like ECH-associated protein 1 (Keap1), is directly modulated by oxidants in the cytoplasm, which
Zhitian Shi et al.
Digestive diseases and sciences, 61(3), 785-794 (2015-11-02)
There is increasing evidence that histidine triad nucleotide-binding protein 1 (HINT1) is a novel tumor suppressor. In the present study, we investigated the mechanism by which HINT1 promotes the stability of inhibitor of NF-κB α (IκBα) in the cytoplasm of
Qijia Yan et al.
Oncotarget, 6(39), 41766-41782 (2015-10-27)
Epstein-Barr virus (EBV) infection is closely associated with tumorigenesis and development of nasopharyngeal carcinoma (NPC), but the underlying molecular mechanisms remain poorly understood. It has been recently reported that EBV encodes 44 mature miRNAs, some of which were found to

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique