Direkt zum Inhalt
Merck

EHU106761

Sigma-Aldrich

MISSION® esiRNA

targeting human STUB1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CAATCTGCAGCGAGCTTACAGCCTGGCCAAGGAGCAGCGGCTGAACTTCGGGGACGACATCCCCAGCGCTCTTCGAATCGCGAAGAAGAAGCGCTGGAACAGCATTGAGGAGCGGCGCATCCACCAGGAGAGCGAGCTGCACTCCTACCTCTCCAGGCTCATTGCCGCGGAGCGTGAGAGGGAGCTGGAAGAGTGCCAGCGAAACCACGAGGGTGATGAGGACGACAGCCACGTCCGGGCCCAGCAGGCCTGCATTGAGGCCAAGCACGACAAGTACATGGCGGACATGGACGAGCTTTTTTCTCAGGTGGATGAGAAGAGGAAGAAGCGAGACATCCCCGACTACCTGTGTGGCAAGATCAGCTTTGAGCTGATGCGGGAGCCGTGCATCACGCCCAGTGGCATCACCTACGACCGCAAGGACATCGAGGAGCACCTGCAGCGTGTGGGTCATTTTGACCCCGTGACCCGGAGCCCCCTGACCCAGGAACAGCTCATCCCCAACTTG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Qasim A Khan et al.
PloS one, 13(7), e0199699-e0199699 (2018-07-07)
ALDH1L1 is a folate-metabolizing enzyme abundant in liver and several other tissues. In human cancers and cell lines derived from malignant tumors, the ALDH1L1 gene is commonly silenced through the promoter methylation. It was suggested that ALDH1L1 limits proliferation capacity
Tao Xu et al.
American journal of cancer research, 7(2), 289-300 (2017-03-25)
Glioblastoma (GBM) is the most frequent, aggressive and fatal tumor in the central nervous system, while PTEN signaling is frequently deregulated in human GBM. We previously reported the up-regulation of the carboxyl terminal of Hsp70-interacting protein (CHIP) in GBM, however
Pengfei Zhang et al.
Cell death and differentiation, 27(11), 3177-3195 (2020-06-03)
Ovarian tumour domain-containing protein 3 (OTUD3), a key OTU (ovarian tumour protease) family deubiquitylase, plays context-dependent roles in cancers. It suppresses tumorigenesis in breast, colon, liver and cervical cancer through stabilizing PTEN (phosphatase and tension homologue deleted on chromosome 10)
Hyo Jeong Yong et al.
Oncotarget, 8(41), 69833-69846 (2017-10-21)
Hypoxia-induced interleukin-32β (IL-32β) shifts the metabolic program to the enhanced glycolytic pathway. In the present study, the underlying mechanism by which hypoxia-induced IL-32β stability is regulated was investigated in ovarian cancer cells. IL-32β expression increased under hypoxic conditions in ovarian
Jian Wang et al.
Oncotarget, 7(49), 81377-81388 (2016-11-12)
The androgen receptor (AR) is not only a ligand-dependent transcription factor, but also functions as a licensing factor, a component of DNA replication, which is degraded during mitosis. Furthermore, the deregulation of AR activity is involved in the initiation of

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.