Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU083661

Sigma-Aldrich

MISSION® esiRNA

targeting human WT1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCAGGGCATGTGTATGTGTCTGCTAATGTAAACTTTGTCATGGTTTCCATTTACTAACAGCAACAGCAAGAAATAAATCAGAGAGCAAGGCATCGGGGGTGAATCTTGTCTAACATTCCCGAGGTCAGCCAGGCTGCTAACCTGGAAAGCAGGATGTAGTTCTGCCAGGCAACTTTTAAAGCTCATGCATTTCAAGCAGCTGAAGAAAAAATCAGAACTAACCAGTACCTCTGTATAGAAATCTAAAAGAATTTTACCATTCAGTTAATTCAATGTGAACACTGGCACACTGCTCTTAAGAAACTATGAAGATCTGAGATTTTTTTGTGTATGTTTTTGACTCTTTTGAGTGGTAATCATATGTGTCTTTATAGATGTACATACCTCCTTGCACAAATGGAG

Ensembl | Human Hinterlegungsnummer

ENSG00000184937

NCBI-Hinterlegungsnummer

NM_024425

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... WT1(7490) , WT1(7490)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xue Wang et al.
Theriogenology, 148, 8-17 (2020-03-04)
To determine the role of 3, 3', 5-triiodo-L thyroxine (T3) in the differentiation of Sertoli cells (SCs) and the factors influencing maturity via the Wilms' tumor 1 (WT1)/non-canonical Wnt signaling pathway, high purity SCs were isolated from newborn calves' testes
Junjie Chen et al.
Journal of experimental & clinical cancer research : CR, 35(1), 173-173 (2016-11-09)
The metastatic cascade is a complex and multistep process with many potential barriers. Recently, miR-193a has been reported to be a suppressive miRNA in multiple types of cancers, but its underlying anti-oncogenic activity in non-small cell lung cancers (NSCLC) is
Tove Ullmark et al.
Biochemical and biophysical research communications, 482(4), 802-807 (2016-11-28)
Wilms' tumor gene 1 (WT1) is a zinc finger transcription factor that has been implicated as an oncogene in leukemia and several other malignancies. When investigating possible gene expression network partners of WT1 in a large acute myeloid leukemia (AML)
Abheepsa Mishra et al.
American journal of physiology. Renal physiology, 314(5), F832-F843 (2018-01-24)
The loss of podocyte (PD) molecular phenotype is an important feature of diabetic podocytopathy. We hypothesized that high glucose (HG) induces dedifferentiation in differentiated podocytes (DPDs) through alterations in the apolipoprotein (APO) L1-microRNA (miR) 193a axis. HG-induced DPD dedifferentiation manifested
Kai Meng et al.
Molecular reproduction and development, 86(11), 1731-1740 (2019-09-07)
Bovine theca cells are thought to differentiate from cortical stromal cells, and ovary-derived Wilms' tumor 1+ (WT1+ ) cells are the primary source of mouse theca cells. However, it is not known whether the differentiation of cortical stromal cells is
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.