Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU031941

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mmp3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGATCTTCGCAGTTGGAATTTGACCCAAATGCCAAAAAAGTGACCCACATATTGAAGAGCAATAGCTGGTTTAATTGTTAAAAAGAGATCCAAGGAAGGCATCCTGTGTTTTAACTGATGCTTATAGTTCTTCATCTGAGTCTTTGTGAAAGGAAGTGCTTTGTTCAGCATGTGCTATGGCAGAACCAAACAGGAGCTATGGATGACACCAGTCAACGTCAAGTTGTCAAAGGATGTTCAGAAGCACTGTGTAGCTTACACTGTGTCCCAAGGAGAGGAG

Ensembl | mouse accession no.

ENSMUSG00000043613

NCBI accession no.

NM_010809

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... MMP3(17392) , Mmp3(17392)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Nobuaki Ozeki et al.
Bioscience trends, 9(3), 160-168 (2015-07-15)
Although it is known that inorganic polyphosphate [Poly(P)] induces differentiation of osteoblasts, there are few reports concerning its effects on cell proliferation, especially in fibroblasts. Because we found that Poly(P) stimulates the proliferation of purified rat dental pulp fibroblast-like cells
Jee Youn Lee et al.
The American journal of pathology, 184(11), 2985-3000 (2014-10-19)
After spinal cord injury (SCI), blood-spinal cord barrier (BSCB) disruption by matrix metalloproteinases (MMPs) leads to BSCB permeability and blood cell infiltration, contributing to permanent neurological disability. Herein, we report that MMP-3 plays a critical role in BSCB disruption after
Debarati Banik et al.
Oncotarget, 6(17), 15164-15179 (2015-05-27)
Interferon regulatory factor-8 (IRF8), originally identified as a leukemic tumor suppressor, can also exert anti-neoplastic activities in solid tumors. We previously showed that IRF8-loss enhanced tumor growth, which was accompanied by reduced tumor-cell susceptibility to apoptosis. However, the impact of
N Ozeki et al.
Oral diseases, 20(5), 505-513 (2013-08-02)
Matrix metalloproteinase (MMP)-3 expression increases after pulpectomy and accelerates angiogenesis in rat dental pulp by an uncharacterised mechanism. Odontoblasts, a major component of dental pulp, could represent a therapeutic target. We investigated whether MMP-3 activity is induced by cytokines and/or

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico