Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU115751

Sigma-Aldrich

MISSION® esiRNA

targeting human PRMT1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGATTATGCGGTGAAGATCGTCAAAGCCAACAAGTTAGACCACGTGGTGACCATCATCAAGGGGAAGGTGGAGGAGGTGGAGCTCCCAGTGGAGAAGGTGGACATCATCATCAGCGAGTGGATGGGCTACTGCCTCTTCTACGAGTCCATGCTCAACACCGTGCTCTATGCCCGGGACAAGTGGCTGGCGCCCGATGGCCTCATCTTCCCAGACCGGGCCACGCTGTATGTGACGGCCATCGAGGACCGGCAGTACAAAGACTACAAGATCCACTGGTGGGAGAACGTGTATGGCTTCGACATGTCTTGCATCAAAGATGTGGCCATTAAGGAGCCCCTAGTGGATGTCGTGGACCCCAAACAGCTGGTCACCAACGCCTGCCTCATAAAGGAGGTGGACATCTATACCGTCAAGGTGGAAGACCTGACC

Ensembl | human accession no.

ENSG00000126457

NCBI accession no.

NM_198319

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PRMT1(3276) , PRMT1(3276)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Eun-Kyung Moon et al.
The Korean journal of parasitology, 55(2), 109-114 (2017-05-17)
Protein arginine methyltransferase (PRMT) is an important epigenetic regulator in eukaryotic cells. During encystation, an essential process for
Jong-Hyun Nho et al.
Biochemical and biophysical research communications, 530(2), 389-395 (2020-06-14)
Recent studies have revealed that protein arginine methyltransferases (PRMTs) are responsible for diverse neurodegenerative diseases. However, their pathophysiological role in dopaminergic neuronal death in Parkinson's disease (PD) has not been evaluated. In this study, we demonstrated that 1-Methyl-4-phenylpyridinium iodide (MPP+)
H Wei et al.
Neoplasma, 66(6), 918-929 (2019-10-15)
Protein arginine methyltransferase 1 (PRMT1) is dysregulated in a number of human cancers. Herein, we report that PRMT1 expression is directly associated with epithelial-mesenchymal transition (EMT) in hepatic carcinoma cells. Firstly, we find that PRMT1 expression is higher in hepatic
Sreedevi Avasarala et al.
The Journal of biological chemistry, 290(21), 13479-13489 (2015-04-08)
Protein arginine methyl transferase 1 (PRMT1) was shown to be up-regulated in cancers and important for cancer cell proliferation. However, the role of PRMT1 in lung cancer progression and metastasis remains incompletely understood. In the present study, we show that
Weiqi Zhai et al.
Journal of immunology (Baltimore, Md. : 1950), 206(1), 11-22 (2020-11-27)
Protein arginine methyltransferase-1 (PRMT1) is an important epigenetic regulator of cell function and contributes to inflammation and remodeling in asthma in a cell type-specific manner. Disease-specific expression patterns of microRNAs (miRNA) are associated with chronic inflammatory lung diseases, including asthma.
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico