Skip to Content
Merck
All Photos(14)

Key Documents

ZRB1994

Sigma-Aldrich

Anti-FOXP1 Antibody, clone 1J11-H1 ZooMAb® Rabbit Monoclonal

enhanced validation
greener alternative

recombinant, expressed in HEK 293 cells

Synonym(s):

Forkhead box protein P1 (UniProt: Mac-1-regulated forkhead, MFH)

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
12352203
NACRES:
NA.43

Pricing and availability is not currently available.

biological source

rabbit

Quality Level

recombinant

expressed in HEK 293 cells

conjugate

unconjugated

antibody form

purified antibody

antibody product type

primary antibodies

clone

1J11-H1, recombinant monoclonal

description

1J11-H1 Clone

product line

ZooMAb® learn more

form

lyophilized

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU107381EHU056021EHU022041
esiRNA cDNA target sequence

CGAACTGGCAGCTTCCTTAGGACTGACACAAACACAGGTGAAGATATGGTTTCAGAACAAACGCTCTAAGTTTAAGAAACTGCTGAAGCAGGGCAGTAATCCTCATGAGAGCGACCCCCTCCAGGGCTCGGCGGCCCTGTCGCCACGCTCGCCAGCGCTGCCTCCAGTCTGGGACGTTTCTGCCTCGGCCAAGGGTGTCAGTATGCCCCCCAACAGCTACATGCCTGGCTATTCTCACTGGTACTCCTCTCCACACCAGGACACGATGCAGAGACCACAGATGATGTGAGTTGCCCAAGGGAACACCCTAGGGAAACGTCTGAACAAGGAAAAGAGGATCCGGGACCTGCTTGTATCTGCGAAAAGGAGCCAAAGGAGCAGGCTTAGGAGAGCTCATAAGTGTGGCAAGAAGCCG

esiRNA cDNA target sequence

TCCCATTTGCAGAAACCCTATGAGATTAACCTGATGGAGGAACTAACTCTGAAGGGAGTAACCCAGTACTACGCATATGTAACTGAGCGCCAAAAAGTACACTGCCTCAACACACTTTTCTCCAGGCTTCAGATAAACCAGTCGATCATTTTCTGTAACTCCTCTCAGCGAGTTGAATTGCTAGCCAAGAAGATTTCTCAACTGGGTTATTCTTGCTTCTATATTCATGCTAAAATGAGGCAGGAACATCGAAATCGTGTATTTCATGATTTCCGAAATGGCTTATGCCGCAATCTTGTTTGCACTGATCTGTTTACCCGAGGTATTGATATACAAGCTGTGAATGTGGTAATAAACTTTGATTTCCCAAAGCTGGCAGAGACCTATCTCCATCGTATTGGAAGATCAGGTCGCTTTGGTCATC

esiRNA cDNA target sequence

GCTCCCCAGCACGATTACTACTCGGGCCAGCCCTATGGCCAGACGGTGAACCCCTACACCTACCACCACCAATTCAATCTCAATGGGCTTGCAGGCACGGGCGCTTACTCGCCCAAGTCGGAATATACCTACGGAGCCTCCTACCGGCAATACGGGGCGTATCGGGAGCAGCCGCTGCCAGCCCAGGACCCAGTGTCGGTGAAGGAGGAGCCGGAAGCAGAGGTGCGCATGGTGAATGGGAAGCCCAAGAAGGTCCGAAAGCCGCGTACGATCTACTCCAGCTACCAGCTGGCCGCCCTGCAGCGCCGCTTCCAGAAGGCCCAGTACCTGGCGCTGCCCGAGCGCGCCGAGCTGGCCGCGCAGCTGGGCCTCACGCAGACACAGGTGAAAATCTGGTTCCAGAACCGCCGTTCCAAGTTCAAGAAACTCTACAAGAACGGGGAGGTG

esiRNA cDNA target sequence

GCGATGACAGGAGTGTTTGACAGAAGGGTCCCCAGCATCCGATCCGGCGACTTCCAAGCTCCGTTCCAGACGTCCGCAGCTATGCACCATCCGTCTCAGGAATCGCCAACTTTGCCCGAGTCTTCAGCTACCGATTCTGACTACTACAGCCCTACGGGGGGAGCCCCGCACGGCTACTGCTCTCCTACCTCGGCTTCCTATGGCAAAGCTCTCAACCCCTACCAGTATCAGTATCACGGCGTGAACGGCTCCGCCGGGAGCTACCCAGCCAAAGCTTATGCCGACTATAGCTACGCTAGCTCCTACCACCAGTACGGCGGCGCCTACAACCGCGTCCCAAGCGCCACCAACCAGCCAGAGAAAGAAGTGACCGAGCCCGAGGTGAGAATGGTGAATGGCAAACCAAAGAAAGTTCGTAAACCCAGGACTATTTATTCCAGCTTTCAGCTGGCCGCATTACAGAGAAGGTTTCAGAAGACTCAGTACCTCGCCTTGC

Gene Information

human ... DLX6(1750), DLX6(1750)

Gene Information

human ... DDX6(1656), DDX6(1656)

Gene Information

human ... DLX3(1747), DLX3(1747)

Gene Information

human ... DLX5(1749), DLX5(1749)

Ensembl | human accession no.

ENSG00000006377

Ensembl | human accession no.

ENSG00000110367

Ensembl | human accession no.

ENSG00000064195

Ensembl | human accession no.

ENSG00000105880

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

General description

We are committed to bringing you greener alternative products, which adhere to one or more of The 12 Principles of Green Chemistry.This antibody is Preservative-free, produced without the harm or sacrifice of animals and exceptionally stable to allow for ambient shipping and storage if needed and thus aligns with "Waste Prevention", "Designing Safer Chemicals" and "Design for Energy Efficiency". Click here for more information.
ZooMAb® antibodies represent an entirely new generation of recombinant monoclonal antibodies.Each ZooMAb® antibody is manufactured using our proprietary recombinant expression system, purified to homogeneity, and precisely dispensed to produce robust and highly reproducible lot-to-lot consistency. Only top-performing clones are released for use by researchers. Each antibody is validated for high specificity and affinity across multiple applications, including its most commonly used application. ZooMAb® antibodies are reliably available and ready to ship when you need them.

Specificity

Clone 1J11-H1 is a ZooMAb® Rabbit recombinant monoclonal antibody that specifically detects Forkhead box protein P1 (FOXP1). It targets an epitope within 16 amino acids from the C-terminal half.

Immunogen

KLH-conjugated linear peptide corresponding to 16 amino acids from the C-terminal half of human Forkhead box protein P1 (FOXP1).

Application

Quality Control Testing

Evaluated by Western Blotting in Daudi cell lysate.

Western Blotting Analysis: A 1:10,000 dilution of this antibody detected FOXP1 in Daudi cell lysate.

Tested Applications

Western Blotting Analysis: A 1:10,000 dilution from a representative lot detected FOXP1 in COS-7 cell lysate.

Immunohistochemistry (Paraffin) Analysis: A 1:100 dilution from a representative lot detected FOXP1 in human prostate tissue sections.

Immunocytochemistry Analysis: A 1:100 dilution from a representative lot detected FOXP1 in MCF-7 cells.

Affinity Binding Assay: A representative lot of this antibody bound FOXP1 with a KD of 3.1 x 10-8 in an affinity binding assay.

Note: Actual optimal working dilutions must be determined by end user as specimens, and experimental conditions may vary with the end user

Target description

Forkhead box protein P1 (UniProt: Mac-1-regulated forkhead, MFH) is encoded by the FOXP1 (also known as HSPC215) gene (Gene ID: 27086) in human. FOXP1 is a transcriptional repressor that can act with C-terminal binding protein 1 (CTBP1) to synergistically repress transcription. It plays an important role in the specification and differentiation of lung epithelium. It can act as a homodimer or can form heterodimers with FOXP2 and FOXP4. Its dimerization is reported to be essential for DNA-binding and its leucine zipper domain (aa 348-369) is required for dimerization and transcriptional repression. It is shown to be an essential transcriptional regulator of B-cell development and is also involved in regulating cardiac muscle cell proliferation and columnar organization of spinal motor neurons. It promotes the formation of the lateral motor neuron column and the preganglionic motor column and is required for respective appropriate motor axon projections. FOXP1 represses transcription of various pro-apoptotic genes and cooperates with NF- B-signaling in promoting B-cell expansion by inhibition of caspase-dependent apoptosis. FOXP1 is expressed in areas of the brain associated with language such as the neocortex and striatum and mutations in FOXP1 gene have been linked to autism spectrum disorder (ASD). This ZooMAb® recombinant monoclonal antibody, generated by our propriety technology, offers significantly enhanced specificity, affinity, reproducibility, and stability over conventional monoclonals. (Ref.: Sollis, E., et al. (2016). Hum. Mol. Genet. 25(3); 546-557; Sin, C., et al. (2015). J. Mol. Neurosci. 55(2); 437-448).

Physical form

Purified recombinant rabbit monoclonal antibody IgG, lyophilized in PBS with 5% Trehalose, normal appearance a coarse or translucent resin. The PBS/trehalose components in the ZooMAb formulation can have the appearance of a semi-solid (bead like gel) after lyophilization. This is a normal phenomenon. Please follow the recommended reconstitution procedure in the data sheet to dissolve the semi-solid, bead-like, gel-appearing material. The resulting antibody solution is completely stable and functional as proven by full functional testing. Contains no biocide or preservatives, such as azide, or any animal by-products. Larger pack sizes provided as multiples of 25 μL.

Reconstitution

300 μg/mL after reconstitution at 25 μL per vial. Please refer to guidance on suggested starting dilutions and/or titers per application and sample type.

Storage and Stability

Recommend storage of lyophilized product at 2-8°C; Before reconstitution, micro-centrifuge vials briefly to spin down material to bottom of the vial; Reconstitute each vial by adding 25 μL of filtered lab grade water or PBS; Reconstituted antibodies can be stored at 2-8°C, or -20°C for long term storage. Avoid repeated freeze-thaws.

Legal Information

ZooMAb is a registered trademark of Merck KGaA, Darmstadt, Germany

Disclaimer

Unless otherwise stated in our catalog or other company documentation accompanying the product(s), our products are intended for research use only and are not to be used for any other purpose, which includes but is not limited to, unauthorized commercial uses, in vitro diagnostic uses, ex vivo or in vivo therapeutic uses or any type of consumption or application to humans or animals.

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

11 - Combustible Solids

WGK

WGK 1

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Sorry, we don't have COAs for this product available online at this time.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service