Skip to Content
Merck
All Photos(1)

Key Documents

EHU129261

Sigma-Aldrich

MISSION® esiRNA

targeting human PAK6, BUB1B-PAK6

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCTGGACAGCTACGTGAAGATTGGCGAGGGCTCCACCGGCATCGTCTGCTTGGCCCGGGAGAAGCACTCGGGCCGCCAGGTGGCCGTCAAGATGATGGACCTCAGGAAGCAGCAGCGCAGGGAGCTGCTCTTCAACGAGGTGGTGATCATGCGGGACTACCAGCACTTCAACGTGGTGGAGATGTACAAGAGCTACCTGGTGGGCGAGGAGCTGTGGGTGCTCATGGAGTTCCTGCAGGGAGGAGCCCTCACAGACATCGTCTCCCAAGTCAGGCTGAATGAGGAGCAGATTGCCACTGTGTGTGAGGCTGTGCTGCAGGCCCTGGCCTACCTGCATGCTCAGGGTGTCATCCACCGGGACATCAAGAGTGACTCCATCCTGCTGACCCTCGATGGCAGGGTGAAGCTCTCGGACTTCGGATTCTGTGCTCAGATCAGCAAAGACGTCCCTAAGAGGAAGTCCCTGGTGGGAACCCCCTACTGGATGGCTCCTGAAGTGATCTCCAGGTCTTTGTATGCCACTGAGGTGGATATCTGGTCTCTGGGCATCATGGTGATTGAGATGGTAGATGGGGAGC

Ensembl | human accession no.

ENSG00000137843

NCBI accession no.

NM_001128628

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PAK6(106821730) , PAK6(56924)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Daniel Pensold et al.
Cerebral cortex (New York, N.Y. : 1991), 27(12), 5696-5714 (2017-11-09)
The proliferative niches in the subpallium generate a rich cellular variety fated for diverse telencephalic regions. The embryonic preoptic area (POA) represents one of these domains giving rise to the pool of cortical GABAergic interneurons and glial cells, in addition
Sally Fram et al.
Cellular and molecular life sciences : CMLS, 71(14), 2759-2773 (2013-12-20)
p-21 activated 6 (PAK6), first identified as interacting with the androgen receptor (AR), is over-expressed in multiple cancer tissues and has been linked to the progression of prostate cancer, however little is known about PAK6 function in the absence of
Jian Zhai et al.
Biochemical and biophysical research communications, 464(1), 161-167 (2015-06-28)
Emerging evidence suggests that microRNAs (miRNAs) play important roles in regulating HCC development and progression; however, the mechanisms by which their specific functions and mechanisms remained to be further explored. miR-129 has been reported in gastric cancers, lung cancer and
Songwang Cai et al.
Oncotarget, 6(6), 3904-3917 (2015-02-26)
Here we found that levels of miR-23a were decreased in prostate cancer cell lines and tumor tissues. These low levels were associated with poor patients' prognosis. MiR-23a inhibited migration and invasion of prostate cancer in vivo and in orthotopic prostate
Weisi Liu et al.
The Journal of biological chemistry, 290(47), 28489-28501 (2015-10-08)
Our previous studies identified the oncogenic role of p21-activated kinase 1 (PAK1) in hepatocellular carcinoma (HCC) and renal cell carcinoma (RCC). Contrarily, PAK6 was found to predict a favorable prognosis in RCC patients. Nevertheless, the ambiguous tumor suppressive function of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service